Recent activity by Dave Riedl

Recent activity by Dave Riedl

Find the ratio of 70cm to 2m

answered Nov 19, 2024

1 answer 62.5k views

What did Aristotle teach incorrectly about the heavens? A. Earth is at the center of the universe B. Stars are made of fire C. The sun is a planet D. The moon emits its own light

asked Oct 28, 2024

1 answer 42.0k views

The doctor ordered bedrest for a resident. What nursing measures help prevent the complications from bedrest?

answered Oct 4, 2024

1 answer 162k views

Why is freedom of the press essential for the political system to work? a. It provides opportunities for government officials to promote topics that are important to them b. It holds government officials

asked Aug 27, 2024

1 answer 205k views

Who was the brave soldier who helped the pilgrims

answered Aug 23, 2024

1 answer 155k views

What is the authors claim of school suspensions don’t work. It’s time for something better. A. School suspensions are effective in addressing behavioral issues. B. School suspensions are ineffective, and

answered Jul 26, 2024

1 answer 68.1k views

asked Jul 4, 2024

1 answer 185k views

Recognition of expense for uncollected accounts receivable under different methods: a. Direct write-off method: When the account is deemed uncollectible b. Method for bad debts: When accounts age past

answered Mar 3, 2024

1 answer 22.8k views

In what order is the process of organizing done? 1) Planning, Organizing, Leading, Controlling 2) Organizing, Planning, Leading, Controlling 3) Planning, Leading, Organizing, Controlling 4) Leading, Organizing,

answered Jan 24, 2024

1 answer 218k views

In the Keynesian framework, most short-run fluctuations in GDP are due to? 1) changes in aggregate demand 2) changes in the natural rate of unemployment 3) changes in potential GDP 4) changes in the unemployment

asked Jan 9, 2024

1 answer 73.7k views

Assuming that the mass of asteroid decreases to its half due to its collision with another asteroid so what happens to the gravitational field intensity?

answered Nov 23, 2023

1 answer 233k views

The mRNA produced by the transcription of a gene encoding an oligopeptide is: 5 'AAAUGAAACCAGGAUAAGAAUU3' while the peptide produced by the translation of the above mRNA is: H2N-methionine-lysine-proline-glycine-COOH

answered Jun 13, 2023

1 answer 123k views

A soccer field (football

asked Apr 28, 2023

1 answer 98.1k views

Which of the following exponential expressions are equivalent to 64? (Select ALL correct answers for full credit).

answered Mar 19, 2023

2 answers 218k views

4. Which of the following best describes earning income through wages? * 1 point being paid per hour of labor like working at Starbucks taking money for sales of goods or services like selling handmade

answered Feb 18, 2023

2 answers 130k views

A 5-kilogram bag of oranges costs $15.16. What is the unit price, rounded to the nearest cent?

answered Jan 15, 2023

1 answer 212k views

Help me with this please someone

answered Jan 14, 2023

2 answers 109k views

How did the compromise of 1877 make the beginning of the end of reconstruction?

asked Jan 5, 2023

1 answer 224k views

Please someone help me (NO LINKS) (NO LYING)

asked Dec 28, 2022

2 answers 20.5k views

Container A is cylinder with a radius of 6 units and a height of 6 units. A right cone has been carved from its base and has a height of 6 units. Container B has the same radius as container A. Which statement

asked Dec 3, 2022

1 answer 87.7k views

Search QAmmunity.org