Recent activity by Meros

Recent activity by Meros

This Stem-and-Leaf Plot shows the number of ice cream cones that a local ice cream parlor sold during the last 25 days. What is the range of the data set? A. 45 B. 43 C. 41 D. 32

asked Dec 26, 2023

2 answers 228k views

Need help finding the answer.

answered Oct 26, 2023

1 answer 46.2k views

Please Help. This is needed to study for my test TOMORROW!!!! Where did the French settle in America and Canada. For America I'm looking for the specific states, and similarly for Canada

asked Sep 8, 2023

1 answer 74.6k views

Which communication roadblock is associated with nonverbal gestures such as finger pointing or turning your back while someone is talking? A. Waffling B. acting C. Judging D. Blaming

answered Jul 29, 2023

1 answer 88.0k views

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.b) Circle the starter and the stopper in

answered Jun 11, 2023

1 answer 4.3k views

If the area of a square shaped rug is 81 in², what is the measurement of ONE SIDE of the rug?

answered Jun 6, 2023

1 answer 226k views

what is the slope of the line that passes through the points (-7,-2) and (-15,-14) write your answer in simplest form

answered May 21, 2023

1 answer 77.9k views

Please help math is hard

asked Mar 9, 2023

2 answers 147k views

Find the difference between(a) 1 yard and 1 meter.=(b) 2 miles and 4000 meters.=(c) 120 yards and 110 meters.=(d) 1 quart and 1 liter.=(e) 8 pounds and 4 kilograms.=

asked Feb 17, 2023

1 answer 194k views

P: x is an even number. If x = 3, then ~p is true or false helpppp

answered Feb 16, 2023

1 answer 67.0k views

How do you address a friend who is your age? A. Tú B. Ustedes C. Usted D. Ella

answered Dec 10, 2022

1 answer 228k views

44% Bill needs to build a rectangular sheep pen. The pen must have a perimeter of 24 m. Every half metres of fencing cost him £1.20. a) Work out the cost of fencing used to make the sheep pen. The length

answered Nov 19, 2022

1 answer 199k views

It is necessary to to secure an inflated balloon tightly give reason

asked Oct 25, 2022

1 answer 30.9k views

The more friends a romantic couple shares, the stronger they may perceive their commitment. A. True B. False

answered Jul 12, 2022

1 answer 218k views

A 2-kilogram bag of birdseed costs $8.54. What is the unit price?

answered Jul 10, 2022

1 answer 140k views

A 2-kilogram bag of birdseed costs $8.54. What is the unit price?

answered Jul 10, 2022

1 answer 140k views

A 2-kilogram bag of birdseed costs $8.54. What is the unit price?

answered Jul 10, 2022

1 answer 140k views

Select the correct form each drop down menu 1: republics theocracies democracies 2: iran north korea china 3: citizens council guardian council leaders council 4: free elections free speech free press

answered Jul 4, 2022

1 answer 36.9k views

What is the answer to this question?

answered Jun 25, 2022

1 answer 41.2k views

❗️❗️❗️please answer fast‼️‼️‼️‼️

answered May 28, 2022

1 answer 179k views

Search QAmmunity.org