Recent activity by Meros

Recent activity by Meros

A stone structure that extends from a wall and employs an arch to focus the strength of the buttress's support at the top of the wall?

answered Nov 30, 2024

1 answer 64.0k views

What are the differences between Closed pack, Open pack, and Neutral Position in the Hip Joint? 1) Closed pack position provides maximum stability and minimal mobility. 2) Open pack position provides maximum

answered Sep 12, 2024

1 answer 234k views

Can Microsoft Access database files be easily copied to create multiple copies of a database? 1) True 2) False

asked Aug 27, 2024

1 answer 145k views

2. Which central idea is discussed in "American Labor and the Great Depression"? a. the effects of Roosevelt's labor legislation ending the Depression b. the effects of most labor legislation enforced

asked Jun 25, 2024

1 answer 84.0k views

An object is suspended by two cables attached at a single point. The force applied on one cable has a magnitude of 125 pounds and acts at an angle of 37°. The force on the other cable is 75 pounds at an

asked May 24, 2024

1 answer 59.5k views

If qv−→− bisects ∠pqr, what is the measure of ∠pqv? a) ∠pqr/2 b) ∠pqr/3 c) ∠pqr/4 d) ∠pqr/5

answered May 4, 2024

1 answer 67.1k views

The four most common netric units for length are:

asked May 1, 2024

1 answer 179k views

How do we use trigonometric parallax to determine the distance to stars?

asked Apr 14, 2024

1 answer 82.5k views

During a graded exercise test, what other criteria may be used to indicate the attainment of a true ?

asked Mar 19, 2024

1 answer 230k views

what tragic event occurred on march 7, 1965 that led president johnson to finally introduce the voting rights act?

asked Mar 6, 2024

1 answer 101k views

This Stem-and-Leaf Plot shows the number of ice cream cones that a local ice cream parlor sold during the last 25 days. What is the range of the data set? A. 45 B. 43 C. 41 D. 32

asked Dec 26, 2023

2 answers 228k views

Need help finding the answer.

answered Oct 26, 2023

1 answer 46.2k views

Please Help. This is needed to study for my test TOMORROW!!!! Where did the French settle in America and Canada. For America I'm looking for the specific states, and similarly for Canada

asked Sep 8, 2023

1 answer 74.6k views

Which communication roadblock is associated with nonverbal gestures such as finger pointing or turning your back while someone is talking? A. Waffling B. acting C. Judging D. Blaming

answered Jul 29, 2023

1 answer 88.0k views

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.b) Circle the starter and the stopper in

answered Jun 11, 2023

1 answer 4.3k views

If the area of a square shaped rug is 81 in², what is the measurement of ONE SIDE of the rug?

answered Jun 6, 2023

1 answer 226k views

what is the slope of the line that passes through the points (-7,-2) and (-15,-14) write your answer in simplest form

answered May 21, 2023

1 answer 77.9k views

Please help math is hard

asked Mar 9, 2023

2 answers 147k views

Find the difference between(a) 1 yard and 1 meter.=(b) 2 miles and 4000 meters.=(c) 120 yards and 110 meters.=(d) 1 quart and 1 liter.=(e) 8 pounds and 4 kilograms.=

asked Feb 17, 2023

1 answer 194k views

P: x is an even number. If x = 3, then ~p is true or false helpppp

answered Feb 16, 2023

1 answer 67.0k views

Search QAmmunity.org