Recent activity by Zeitgeist

Recent activity by Zeitgeist

Many Native Americans died from disease due to the Columbian Exchange. What is the Columbian Exchange? a) The exchange of goods between Europe and Asia. b) The exchange of diseases between the Old and

answered Sep 29, 2024

1 answer 71.1k views

What is the cost of 90 c.m when 1 meter cloth is 25 rupees

answered May 26, 2024

1 answer 84.8k views

The components of a vertical circuit board, 150 mm on a side, dissipate 5 W. The back surface is well insulated and the front surface is exposed to quiescent air at 27 ∘c Assuming a uniform surface heat

answered Mar 13, 2024

1 answer 214k views

Which statement about the graph of (f) is true? a. It crosses the x-axis at (e). b. It crosses the y-axis at (e). c. It passes through the point ((1, e)). d. It crosses the x-axis at (e).

answered Feb 26, 2024

1 answer 227k views

√64-7x = 22 Find what x is

answered Jan 5, 2024

1 answer 35.5k views

Find the value of the variable and the measure of each labeled angle.x=.... (Type a whole number.) (x+14) = ....(Type a whole number.) (5x -50) =... (Type a whole number.)

asked Oct 7, 2023

1 answer 1.1k views

Find the value of x, y, and z.

answered Sep 7, 2023

1 answer 166k views

Read the sentences. My brother is a weird boy. I never understand what he is thinking. My brother is a unique boy. He has a very creative side. Which sentence correctly describes the connotations of the

answered May 11, 2023

2 answers 144k views

Need some help! please be specific on how to do it

answered May 7, 2023

1 answer 29.1k views

John proctor sinner or christ like

asked Apr 28, 2023

1 answer 152k views

Which equation could match the table? (the table is shown in the picture) A. y=3x+2 B. y=2x +3 C. y=x+3 D. y=2x- 3

answered Mar 24, 2023

1 answer 129k views

What type of slope is demonstrated by the line below?(5,5)(5,-5)A. Zero slopeB. Undefined slopeC. Positive slopeD. Negative slope

answered Feb 25, 2023

2 answers 55.3k views

which of the following had the greatest impact on health insurance coverage due to medicaid expansion under the aca?

answered Feb 14, 2023

1 answer 178k views

Solve for y 5y-25=75

answered Dec 24, 2022

2 answers 169k views

Help, somebodyyyyyy aaaaa I need an explanation :<

asked Dec 3, 2022

1 answer 62.8k views

Solve the linear system by graphing y=x+2 and y=-6x+9

asked Nov 25, 2022

1 answer 108k views

Can somebody help me with this pleaseee

asked Nov 21, 2022

1 answer 55.9k views

TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA

asked Oct 26, 2022

1 answer 86.1k views

Find the distance across the lake, assume the triangles are similar

asked Oct 13, 2022

1 answer 111k views

On a science test, 2 points are deducted from a total of 100 points for each question answered incorrectly. Trevor scored an 84 on the test. The equation 100−2x=84, where x represents the number of questions

asked Sep 4, 2022

2 answers 50.6k views

Search QAmmunity.org