Recent activity by Zeitgeist

Recent activity by Zeitgeist

Find the value of the variable and the measure of each labeled angle.x=.... (Type a whole number.) (x+14) = ....(Type a whole number.) (5x -50) =... (Type a whole number.)

asked Oct 7, 2023

1 answer 1.1k views

Find the value of x, y, and z.

answered Sep 7, 2023

1 answer 166k views

Read the sentences. My brother is a weird boy. I never understand what he is thinking. My brother is a unique boy. He has a very creative side. Which sentence correctly describes the connotations of the

answered May 11, 2023

2 answers 144k views

Need some help! please be specific on how to do it

answered May 7, 2023

1 answer 29.1k views

John proctor sinner or christ like

asked Apr 28, 2023

1 answer 152k views

Which equation could match the table? (the table is shown in the picture) A. y=3x+2 B. y=2x +3 C. y=x+3 D. y=2x- 3

answered Mar 24, 2023

1 answer 129k views

What type of slope is demonstrated by the line below?(5,5)(5,-5)A. Zero slopeB. Undefined slopeC. Positive slopeD. Negative slope

answered Feb 25, 2023

2 answers 55.3k views

which of the following had the greatest impact on health insurance coverage due to medicaid expansion under the aca?

answered Feb 14, 2023

1 answer 178k views

Solve for y 5y-25=75

answered Dec 24, 2022

2 answers 169k views

Help, somebodyyyyyy aaaaa I need an explanation :<

asked Dec 3, 2022

1 answer 62.8k views

Solve the linear system by graphing y=x+2 and y=-6x+9

asked Nov 25, 2022

1 answer 108k views

Can somebody help me with this pleaseee

asked Nov 21, 2022

1 answer 55.9k views

TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA

asked Oct 26, 2022

1 answer 86.1k views

Find the distance across the lake, assume the triangles are similar

asked Oct 13, 2022

1 answer 111k views

On a science test, 2 points are deducted from a total of 100 points for each question answered incorrectly. Trevor scored an 84 on the test. The equation 100−2x=84, where x represents the number of questions

asked Sep 4, 2022

2 answers 50.6k views

What is -14n+1=rt-4n, solving for n

asked Aug 17, 2022

1 answer 28.6k views

Y’all know the answer for this

asked May 19, 2022

1 answer 101k views

what motivated Gracia to spend most weekends exploring and mapping the islands complex system of underwater caves

asked May 11, 2022

1 answer 108k views

What is the best way for u to describe run-on sentences

asked Apr 25, 2022

2 answers 38.0k views

Name the 2 circulations in a double circulation. awnser asap

asked Mar 28, 2022

2 answers 184k views

Search QAmmunity.org