Recent activity by Will Manley

Question

Which selection BEST summarizes HOW different groups feel about Disney's attempt to trademark the term "Día de los Muertos"? Members of the Mexican community were angry that Disney was trying to take ownership

asked Dec 24, 2024

1 answer 91.8k views

The balance sheet valuation of inventories is: 1) lower of cost or market. 2) lower of selling price or cost. 3) lower of realizable value or selling price. 4) cost, regardless of the cost of replacing

asked Apr 18, 2024

1 answer 222k views

Consider a two-period binomial model, where each period is 6 months. Assume the stock price is $46.00, o=0.28, r=0.06 and the dividend yield is 2.0%. What is the maximum approximate strike price where

answered Mar 12, 2024

1 answer 106k views

Who is the speaker in Macbeth? 1) Macbeth 2) Macduff 3) The witches 4) Cannot be determined

answered Mar 12, 2024

1 answer 108k views

100 POINTS HELP PLEASE Which of these is an example of a chemical property? A. Table salt is a white crystal. B. Sodium metal boils at 883 °C. C. Sodium oxidizes in air. D. Gold has a density of 19 g/cm³.

asked Mar 11, 2024

2 answers 71.8k views

Anyone know how to solve this? 64^-3m = 16^-2m-2

asked Mar 7, 2024

1 answer 113k views

A patient with muscular dystrophy starts to receive stem cells that generate muscle tissue. Which is the best prediction of what will happen to the patient's muscle function? muscle function should decrease

answered Dec 20, 2023

2 answers 94.9k views

Trig Project 1.) The plane left LaGuardia Airport at 3:25 pm and, about two minutes later, struck a flock of birds. The plane had travelled four miles from LaGuardia and was ascending at an angle of elevation

answered Dec 19, 2023

1 answer 69.2k views

On December 31, the balance in the office supplies account is $1,300. A physical count shows $510 worth of supplies on hand Required: Prepare the adjusting entry tor supplies.: Refer to the Chart of Accounts

asked Dec 11, 2023

1 answer 143k views

3. Tanzila made a deposit to her bank account of $140 and then withdrew $140. How much did her bank account change?

asked Sep 2, 2023

1 answer 182k views

Hy are nonrenewable resources used even when renewable resources might be available?

answered Jul 26, 2023

1 answer 209k views

Find the volume of this cone.Use 3 for TT.4 cmV ==Tir2h3Hint: The radius (l) is1/2 of the diameter.18 cmV ~ [?]cm3

asked Jul 1, 2023

1 answer 119k views

Does anyone know how to write an equation for two points of (0,-3) and (8,-5) PLEASE HELP

answered Apr 24, 2023

1 answer 96.4k views

A line segment with endpoints P(1, 2) and Q (4,3) Is reflected across the line y=x. What are the new coordinates of the endpoints of the line segment?

answered Apr 19, 2023

1 answer 12.0k views

Using the same, non-mutated sequence of DNA , repeat the process you just completed, but this time, for an insertion mutation. Randomly insert a base. Original DNA gene: GATCGATACCATTCGGCGCATACTTCG A)The

answered Dec 4, 2022

1 answer 146k views

Mis padres_________aman. mi ellos tí me

answered Nov 29, 2022

2 answers 46.9k views

A coin is resting on the bottom of an empty container. The container is then filled to the brim three times, each time with a different liquid. An observer (in air) is directly above the coin and looks

answered Nov 11, 2022

1 answer 2.0k views

Co (5. 00 g) and co2 (5. 00 g) were placed in a 750. 0 ml container at 50. 0 °c. The partial pressure of co in the container was ________ atm.

asked Nov 2, 2022

1 answer 129k views

What is the Sahel? an African territory that is of historical importance a landform found only in Africa, it is a cross between a mountain and a plateau a climatic event with high winds and heavy rains

answered Oct 18, 2022

2 answers 2.3k views

Caring for a Pet Including children in caring for a pet can be a positive experience. It teaches children valuable lessons. Abiding by the decision to take care of a pet teaches young children accountability.

answered Oct 5, 2022

1 answer 164k views

Ask a Question