Recent activity by Vlatkozelka

Recent activity by Vlatkozelka

How did Christopher Columbus contribute to the erasure of the Taino people?

asked Nov 22, 2023

2 answers 306k views

4(x+y)^(2) -20(x+y)^(2) +25z^(2)

answered Nov 14, 2023

2 answers 356k views

Donna is making a cookie recipe that calls for 1 ¾ cups of sugar. However, when she goes to take out the measuring cups she can only find the one-half cup measuring cup. How many one-half cups will she

asked Nov 4, 2023

1 answer 31.9k views

The lower and upper fixed points of a mercury-in-glass thermometer are marked X and 180mm respectively. On a particular day the mercury meniscus in the thermometer rises to 60mm. If the corresponding reading

asked Oct 24, 2023

1 answer 514k views

Please help !!! Hurry!!!

answered Aug 4, 2023

1 answer 436k views

So I'm trying to figure out if this passage is Cause and Effect or Problem and Solution. please help And don't tell me the wrong answer pls.. I need to get this done quickly

asked Jul 2, 2023

1 answer 469k views

In DNA replication...*1 pointRNA makes a copy of itself with the help of enzymesProteins make a copy of themselves using enzymesDNA makes a copy of itself with the help of enzymesThe cell makes a copy

asked Mar 13, 2023

1 answer 111k views

I need help finding the area I have a huge test tomorrow and I’m nervous.

answered Jan 27, 2023

1 answer 496k views

3/4 + 4/7 + 3/4 plz help

answered Dec 2, 2022

2 answers 94.6k views

Oceanside bike rental shop charges 14 dollars plus 7 dollars an hour for renting a bike. Sara paid 77 dollars to rent a bike. How many hours did she pay to have the bike checked out

asked Sep 3, 2022

1 answer 95.0k views

Slope: -1/4 y-intercept: 12 what is the equation of line. a: y=4x-12 b: y=-1/4x+12 c: y=12x-1/4 d: y=12x=4

answered Jun 22, 2022

2 answers 179k views

. Cost. A circular terrace has a radius of 6 ft. If it costs $1.50 per square foot to pave the terrace with brick, what will the total cost be?

asked Jun 9, 2022

1 answer 388k views

Follow the link to the MaxExpect server that generates a specified group of structures from a sequence, either RNA or DNA. Use the RNA sequence below to predict its structure identity. Sequence: GGAGAGGCCUGGCCGAGUGGUUAAGGCGAUGGACUGCUAAUCCAUUGUGCUCUGCACGCGUGGGUUCGAAUCCCAUCCUCGUCG

answered Apr 10, 2022

1 answer 385k views

A carton has a length of feet, width of feet, and height of feet. What is the volume of the carton?

asked Mar 24, 2022

1 answer 102k views

Search QAmmunity.org