Recent activity by Timur Mustafaev

Question

Dallas: "Bikini's on Miscle Beach". Like to see some muscle? *he props his feet next to her* / 1. Yes 2. No

asked Nov 14, 2024

1 answer 215k views

Find the radius of a circle with a circumference of 4/5 pi.

answered Oct 29, 2024

1 answer 143k views

What regulates and controls the development of the land and buildings within the applicable municipal boundaries?

answered Oct 19, 2024

1 answer 77.3k views

3. What is the angle of rotation of the following figure? 180° 60° 90° 45°

asked Sep 25, 2024

2 answers 85.0k views

Max was overwhelmed with his college coursework and decided to reduce his course load from 6 to 5 classes in the fall express this change as a percent

answered Sep 22, 2024

1 answer 123k views

How to run astral ii on command line

answered Aug 29, 2024

2 answers 103k views

Carlos was born into a Spanish-speaking household and as an infant he made many babbling sounds that could be identified as Chinese or Swahili, in addition to those that sounded Spanish. Now, as an adult,

answered Jun 26, 2024

1 answer 44.0k views

Why might topical, cosmetic application of atropine or scopolamine from the belladonna plant not cause fatal poisoning, as would occur with ingestion of the plant?

asked May 28, 2024

1 answer 97.7k views

Consider the partially completed one-way ANOVA summary table below. In conducting the test whether all the population means are equal, all of the below assumptions must hold except the populations follow.

asked Apr 4, 2024

1 answer 42.9k views

Which term can be used in the blank of 3662−222 so the greatest common factor of the resulting polynomial is 2? a. 12 b. 18 c. 24 d. 36

asked Feb 23, 2024

1 answer 186k views

What's the purpose of a counterargument paragraph? To introduce a main point that proves your thesis To give the opposing argument equal space in your paper To address an opposing argument and refute it

answered Feb 2, 2024

1 answer 217k views

Identify the altele(s) in this stretch of DNA. The top fragment is from the paternal chromosome and the bottom fragment is from the maternal chromosome. GCAATCAGTCAGTCAGTTATCGGG GCAATCAGTCAGTCAGTCAGTCAGTTATCGGG

answered Jan 26, 2024

1 answer 234k views

Dr. David Smith lived 1/13 of his life as a child. He spent 4/39 of his life preparing for an outstanding medical career. For 1/ 2 of his life, he was a successful surgeon in a famous children's hospital.

answered Nov 30, 2023

1 answer 39.6k views

Two stores are having sales on the same shirt. the sale at store 1 is "2 shirts for $22" and the sale at store 2 is "each $12.99 shirt is 10% off". explain how much will you save by buying at store 1.

asked Sep 21, 2023

2 answers 125k views

A car dealer will sell you a used car for $6,298 with $798 down and payments of $168.51 per month for 48 months. What is the simple interest rate? (Round your answer to the nearest tenth of a percent.)

asked Sep 4, 2023

1 answer 198k views

Madison has a round garden. The diameter is 14 feet. What is the area of the garden? use π = 3.14.

asked Jun 4, 2023

1 answer 203k views

Several poles, that were 0.4 meters in length, were attached end to end to form a pole that was 150 meters long. How many poles, 0.4 meters in length, were attached?

asked May 27, 2023

1 answer 188k views

Which of the following cases would be least likely to result in a manager creating an exception in a company's dress code. A. Sam wants to wear jeans to work because he finds dress pants uncomfortable.

answered May 8, 2023

1 answer 223k views

How does business decisions affect the business cycle

asked Apr 27, 2023

1 answer 6.6k views

roger Scored 18 goals for his soccer team for the 2019 season. during games one and two, he scored 3 goals each game. How many goals did he average in the remaining games if he played in a total of 8 games?

answered Feb 19, 2023

1 answer 156k views

Ask a Question