Recent activity by Slava Chernyak

Recent activity by Slava Chernyak

The sum of all interior angles in a polygon is 9 degrees. How many sides does the polygon have? Please show your working.

asked Nov 21, 2024

1 answer 115k views

What SI unit is used for measurements of temperature? A) Fahrenheit B) Celsius C) Kelvin D) none of the above

asked Oct 11, 2024

1 answer 77.3k views

Whole life insurance, a.k.a. cash value insurance "...is one of the worst ________ products on the market today." a) Investment b) Health c) Retirement d) Travel

answered Oct 6, 2024

1 answer 214k views

_________ is accomplished by matching what is seen outside the cockpit with the features found on a chart.

asked Sep 11, 2024

1 answer 52.5k views

Explain the following auditory processes: Vowel Reduction Deletion

asked Sep 11, 2024

1 answer 176k views

What are some behaviours associated with Sleepiness and breathing changes?

asked Aug 9, 2024

1 answer 11.8k views

What are the signs and symptoms of respiratory acidosis? 1) Severe dyspnea with signs suggestive of respiratory muscle fatigue, increased WOB, use of accessory muscles, paradoxical breathing, and retractions

asked Jul 28, 2024

1 answer 46.6k views

Slope of the line that passes through the points (8,-6) and (5,-1)

answered Jun 14, 2024

1 answer 131k views

Find the term that best defines the sacculations and longitudinal smooth muscle bands of the cecum and colon as found in swine and horses. a) Haustra b) Taeniae coli c) Villi d) Rugae

asked May 20, 2024

1 answer 145k views

Gia is thinking of a number, which she calls n. She adds 4 to the number and then doubles the sum. Write an expression to represent Gia's number.

answered Apr 3, 2024

2 answers 77.2k views

Write out the sequence of amino acids that make up the protein from the following mRNA strand AUGGCUGGAUGGCUCUCGACUUAGAAAUGA

answered Jan 26, 2024

1 answer 154k views

The data below represents the scores in a golf tournament. If the mean is 70 with a standard deviation of 4.9, circle all values with a z-score greater than 0.5 {63, 64, 65, 67, 70, 71, 73, 73, 76, 78}

answered Jan 2, 2024

1 answer 118k views

23 Which answer choice represents 4 as a mixed number? 5-/1/2 51-1 CT 3/4 61/1

answered Nov 29, 2023

2 answers 11.2k views

Which of the following is the best estimate of the temperature at 11:00 pm if the temperature continues to drop at the same rate?

answered Oct 8, 2023

1 answer 19.8k views

Write an expression to represent: Six less than the product of four and a number x.

answered Sep 18, 2023

2 answers 78.2k views

Graph the solution to the following system of inequalities x < - 4 y >= - 8 3x + 5y <= - 20

asked Aug 16, 2023

1 answer 66.4k views

Irrigation increased: a. The production of crops. b. The need for an organizing body or government. c. All of the above.

asked Aug 12, 2023

1 answer 168k views

Compare and contrast the role of music in Ancient Greek and Roman cultures.

answered Aug 1, 2023

1 answer 131k views

What is the best way to describe the center of the data represented in this line plot? Select from the drop-down menus to correctly complete the statement. The Choose... is Choose... .

answered Jul 2, 2023

2 answers 68.7k views

In one season a basketball player missed 50 % of her free throws. How many free throws did she attempt if she made 162 free throws?AnswerIT Keypad

asked Jun 19, 2023

1 answer 192k views

Search QAmmunity.org