Recent activity by Slava Chernyak

Question

A number of weight loss products advertised on television feature doctors who note the safety and effectiveness of the product. This approach to convincing viewers to purchase the product is an example

asked Dec 12, 2024

1 answer 43.8k views

The sum of all interior angles in a polygon is 9 degrees. How many sides does the polygon have? Please show your working.

asked Nov 21, 2024

1 answer 115k views

What SI unit is used for measurements of temperature? A) Fahrenheit B) Celsius C) Kelvin D) none of the above

asked Oct 11, 2024

1 answer 77.3k views

Whole life insurance, a.k.a. cash value insurance "...is one of the worst ________ products on the market today." a) Investment b) Health c) Retirement d) Travel

answered Oct 6, 2024

1 answer 214k views

Backpack sprayers are a good choice to apply pesticides in homes and small businesses. a-true b-false

asked Oct 3, 2024

1 answer 72.1k views

_________ is accomplished by matching what is seen outside the cockpit with the features found on a chart.

asked Sep 11, 2024

1 answer 52.5k views

Explain the following auditory processes: Vowel Reduction Deletion

asked Sep 11, 2024

1 answer 176k views

Irony does all of the following except act as sarcasm emphasize the point the speaker is trying to make function as a rhetorical device say the opposite of what the speaker means

asked Sep 6, 2024

2 answers 151k views

Which of the following is not a common cause of vehicle fires? A. Electrical short circuits due to loose connections. B. Improper use of flares. C. Loose air lines. D. Improperly sealed flammable cargo.

asked Aug 25, 2024

1 answer 64.7k views

What are some behaviours associated with Sleepiness and breathing changes?

asked Aug 9, 2024

1 answer 11.8k views

What are the signs and symptoms of respiratory acidosis? 1) Severe dyspnea with signs suggestive of respiratory muscle fatigue, increased WOB, use of accessory muscles, paradoxical breathing, and retractions

asked Jul 28, 2024

1 answer 46.6k views

Slope of the line that passes through the points (8,-6) and (5,-1)

answered Jun 14, 2024

1 answer 131k views

Find the term that best defines the sacculations and longitudinal smooth muscle bands of the cecum and colon as found in swine and horses. a) Haustra b) Taeniae coli c) Villi d) Rugae

asked May 20, 2024

1 answer 145k views

Gia is thinking of a number, which she calls n. She adds 4 to the number and then doubles the sum. Write an expression to represent Gia's number.

answered Apr 3, 2024

2 answers 77.2k views

Completa el espacio en blanco con la mejor respuesta. necesito comprar un sofÃ¡. debo ir a una __________. mueblerÃa jugueterÃa ferreterÃa carnicerÃa

answered Mar 19, 2024

2 answers 218k views

Write out the sequence of amino acids that make up the protein from the following mRNA strand AUGGCUGGAUGGCUCUCGACUUAGAAAUGA

answered Jan 26, 2024

1 answer 154k views

The data below represents the scores in a golf tournament. If the mean is 70 with a standard deviation of 4.9, circle all values with a z-score greater than 0.5 {63, 64, 65, 67, 70, 71, 73, 73, 76, 78}

answered Jan 2, 2024

1 answer 118k views

23 Which answer choice represents 4 as a mixed number? 5-/1/2 51-1 CT 3/4 61/1

answered Nov 29, 2023

2 answers 11.2k views

Which of the following is the best estimate of the temperature at 11:00 pm if the temperature continues to drop at the same rate?

answered Oct 8, 2023

1 answer 19.8k views

Write an expression to represent: Six less than the product of four and a number x.

answered Sep 18, 2023

2 answers 78.2k views

Ask a Question