Recent activity by Rnwood

Recent activity by Rnwood

The next to last major stage in writing is

answered Sep 25, 2023

1 answer 171k views

20pts Income and education both represent which type of market segmentation? O A demographic OB. psychographic OC. polygraphic O D. metrographic

answered Aug 28, 2023

1 answer 184k views

Most marine invertebrates are osmoconformers. This means that:.

answered Aug 11, 2023

1 answer 70.7k views

Identify the real and imaginary parts of the following complex number 64 - 7i

asked Jun 14, 2023

1 answer 163k views

3 3/8 x 7 1/4 with explanation

asked Apr 26, 2023

1 answer 218k views

What is Anne's tone in this passage? What is Anne's perspective toward her family?

asked Apr 11, 2023

2 answers 102k views

A local farmer breeds only her best cows, especially those that put out more milk. what process is the dairy farmer using to het a desired trait in offspring ?

asked Apr 1, 2023

1 answer 85.7k views

13. Janet bought some markers for $3 each, and a notebook for $5. Janet did not spend more than $17, which inequality can be used to find y, the number of markers that Janet could have bought? o 34+ 5

asked Mar 11, 2023

1 answer 66.1k views

White gold is made from gold, palladium, nickel and zinc in the ratio 15:2:2:1. A white gold ring contains 9g of gold. What is the mass of the ring?

answered Feb 23, 2023

2 answers 174k views

Why are cases in the U.S. Supreme Court called oral arguments instead of trials? Please no Goo.gle! Thanks

answered Dec 28, 2022

2 answers 125k views

In which colony did the "Starving Time" occur? A.vermot B.maine C.plymouth D.jamestown

answered Dec 11, 2022

2 answers 179k views

What is this passage mostly about? A. which music is the best B. different musical tastes C. a brother's favorite music D. different types of music

asked Nov 25, 2022

2 answers 167k views

b) A dealer bought a laptop for Rs 45,000 and sold it to a retailer at 12% profit. The retailer again sold it to a customer at 25% profit. How much did the customer pay for the laptop?

asked Oct 17, 2022

1 answer 145k views

Which of the following is a given power to the federal government Making marriage laws. Declaring war. Creating local governments. Setting up schools.

answered Jun 29, 2022

1 answer 53.9k views

1. Solve the equations below using a number line. Click above the fraction line to record the numerator and below the fraction line to record the denominator. 7. 5/5 + 2/5 = 7/5 Who does this look on a

asked Jun 24, 2022

2 answers 31.3k views

TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.

asked Jun 20, 2022

1 answer 35.6k views

What are the atomic number and atomic weight of iron.

answered Jun 10, 2022

2 answers 180k views

What world war ii leader won a nobel prize for literature?

answered May 14, 2022

1 answer 22.9k views

A group of friends share 3 slices of cake. Each friend gets half a slice of cake. How many friends shared the slices of cake? Use the drop-down menus to complete the statements.

asked May 2, 2022

1 answer 39.1k views

nerissa has 5 pink bows,1 blue bow ,and 4 purple bows in a box she will randomly choose 1 bow from the box. what is the probability nerissa will choose purple bow

answered Apr 18, 2022

2 answers 129k views

Search QAmmunity.org