Recent activity by Minlare

Recent activity by Minlare

The fishes are strong swimmers, have keen senses, and are expert predators: A) Cartilaginous fishes B) Bony fishes C) Ray-finned fishes D) Elasmobranchs

asked Dec 3, 2024

1 answer 84.2k views

Who was a Renaissance writer whose work was based on their professional experience ? Miguel de Cervantes Sancho Panza Dante Alighieri Baldassare Castiglione

answered Nov 29, 2024

2 answers 181k views

Explain the dynamics of an auto lease between a consumer and a car dealer.

answered Nov 28, 2024

1 answer 50.6k views

Which of the following climate areas has hot and wet, almost tropical summers, but relatively cool winters? The south. The high plains. The north-west. The mid-Atlantic. The southeast.

answered Nov 12, 2024

1 answer 161k views

What items are valid identifiers to establish a patient's identification?

asked Oct 27, 2024

1 answer 226k views

Simplify the expression: ÷ (-4)-(-8)

answered Oct 26, 2024

1 answer 67.0k views

Use the echelon method to solve the following system of two equations in two unknowns. Check your answer. 4x−3y=−1 −8x+6y=2 Select the correct choice below and, if necessary, fill in the answer box to

answered Oct 18, 2024

1 answer 103k views

According to the attachment theory, relationship disorders are related to trauma associated with A. Insufficient food and/ or shelter B. Siblings and/ or strangers. C. Caregivers and/or parents D. Culture

asked Oct 11, 2024

1 answer 71.1k views

Give me three types of control systems

answered Oct 8, 2024

2 answers 207k views

In the fourteenth century, the Sultanate of Delhi extended its power into which region? 1) Central Asia 2) South India 3) Southeast Asia 4) Persia

asked Sep 12, 2024

1 answer 48.3k views

1. What is the sequence of amino acids that would be made from the following DNA template sequence as a result of transcription and translation? AGGCTATTGCATCCCTTGAGA

asked Sep 11, 2024

1 answer 51.8k views

I don't understand how to do this.

answered Jul 28, 2024

2 answers 125k views

Why did President Roosevelt create the Office of War Information (OWI) in 1942?

answered Jul 24, 2024

1 answer 2.1k views

What is the proper way to determine a quote time?

asked Jul 9, 2024

1 answer 129k views

If you were offered a job would you choose the one with the pay increase according to an arithmetic sequence formula or a geometric sequence formula? Justify your response.

answered May 25, 2024

1 answer 52.1k views

Which conclusion can be made about how the time period in which she lived affected Princess Margaret? O If she had been born in an earlier time period, nobody would have noticed her divorce. An earlier

asked Feb 25, 2024

1 answer 9.3k views

Characteristics of australoids?

answered Nov 22, 2023

1 answer 111k views

What was the purpose of salons? They were markets for buying and selling goods. They were religious events for reforming the church. They were places where lawmakers went to write laws. They were social

answered Jul 28, 2023

2 answers 229k views

In Beowulf, King Hrothgar's hall has been deserted for 12 years. Explain why.

answered Jul 19, 2023

1 answer 151k views

Which Romantic composers were MOST focused on the use of their ethnic and national folk traditions in their work?

answered Jul 9, 2023

1 answer 104k views

Search QAmmunity.org