Recent activity by Lakshitha

Question

Acenaphthylene, a hydrocarbon that is a constituent of a coal tar, is 94.71% and has a molar mass of 152.19 g/mol. What are the empirical and molecular formulas of acenaphthylene?

answered Oct 31, 2023

1 answer 198k views

three of the 30 computers are out of service what percent of the computers are working show your work

answered Oct 26, 2023

2 answers 119k views

Which factor aided the growth of settlements in Arkansas Territory? a. decline of cotton agriculture in the south b. abolition of slavery in Missouri c. use of keelboats on the Arkansas River d. popularity

asked Sep 8, 2023

1 answer 230k views

A cross-section of a right triangular prism is created by a plane cut through the points shown and is also perpendicular to the opposite base. What is the most specific name of the shape representing the

answered Aug 21, 2023

1 answer 223k views

Janey paints block of wood with gold glitter for an art project. The block measures 8 inches by 10 inches by 20 inches. after she's done she decides to make two blocks by cutting through the block on the

answered Aug 16, 2023

1 answer 110k views

What is the mean absolute deviation of 1, 2, 2, 3, 5, 6, 6, 8, 8, 9

asked May 19, 2023

1 answer 131k views

En la puerta del sol se encuentra el kilómetro cero de las carreteras españolas.

asked Apr 17, 2023

1 answer 53.8k views

Which aspect of a play would most likely be the same no matter how the play is adapted? A. the plays time period B. the appearance of the plays characters C. the plays themes D. the plays settings

answered Mar 19, 2023

1 answer 21.3k views

(3x-1)^3 binomial cube PLS FAST!!!!

answered Jan 12, 2023

2 answers 2.5k views

describe two ways that the development of Egyptian civilization was influenced by its geographic location.

answered Nov 22, 2022

1 answer 95.5k views

What is the mRNA in TACCGGATGCCAGATCAAATC?

asked Nov 13, 2022

1 answer 173k views

What is the 5th step a biologist must do to precede from an idea to a published article. * a. report conclusions b. develop technologies c. analyze data d. research disease e. ask a question f. create

answered Oct 25, 2022

1 answer 119k views

A ___ mutation occurs when a base in the DNA sequence is replaced by a different base. Answers: substitution aggression deletion insertion

asked Sep 28, 2022

2 answers 162k views

Which ended Mongol rule in China? 1. invasion by nomadic horsemen from the north 2. Kublai Khan's conversion to Confucianism 3. competition among the Mongols and foreigners 4. an uprising led by a peasant

asked Sep 15, 2022

2 answers 202k views

The distance between two points A and B on latitude 60°S along their parallel of latitude is 2816km. (I) calculate the angular difference in their longitudes (ii) if A is due west of B and on longitude

answered Sep 9, 2022

1 answer 9.1k views

What is the name of the people who followed Adolf Hitler’s commands A. Germans B. Italians C. Japanese D. Nazis

answered Jul 6, 2022

2 answers 5.8k views

What does it mean element????

answered Jun 13, 2022

2 answers 153k views

How many gallons are in half a quart

answered May 9, 2022

2 answers 168k views

A body of mass 2kg is suspended from the ceiling of a lift with a light inextensible string. If the lift moves upwards with acceleration of 2ms-2, what is the magnitude of the tension in the string (g

answered Apr 27, 2022

1 answer 177k views

ANSWER THESE 3 QUESTIONS OF THESE FOR 30 POINTS, THANK YOU!! 1. Solve x2 = −169 A. undefined B. 13 C. ±13 D. −13 2. Identify square root of 3 as either rational or irrational, and approximate to the tenths

asked Apr 9, 2022

2 answers 128k views

Ask a Question