Recent activity by Lakshitha

Recent activity by Lakshitha

The leader of the House of Representatives What is a faithless elector? a person that votes a person that uses against the popular the popular vote to vote of their state cast electoral votes the head

answered Dec 29, 2024

1 answer 35.1k views

Whose appreciation for old southern mansions does Hathaway express? a) Drysdale's b) Granny's c) Elly's d) Jethro's

answered Dec 22, 2024

2 answers 43.7k views

Two sets of solid, double, yellow lines that are two or more feet apart: ________. 1) Indicate a no-passing zone 2) Indicate a passing zone 3) Indicate a construction zone 4) Indicate a school zone

answered Nov 10, 2024

1 answer 192k views

Explain the physical layer structure of bipolar junction transistor (BJT) with the help of symbolic structure. [CLO 1]

answered Aug 22, 2024

1 answer 189k views

A florist buys a dozen roses for $12.24 and sells them for $46.80. Find the amount of markup on a single rose.

asked Jul 12, 2024

1 answer 34.6k views

This group of people had very labor intensive jobs; like fishing and farming and wanted independence from Britain. a. Loyalists b. Patriots c. Neutrals

answered Jun 22, 2024

1 answer 74.5k views

What is the average Factor in the given comparison? A) 0.18 B) 4 C) 0.99 D) 5.60

asked May 23, 2024

1 answer 225k views

Find the area of a hexagon with a side length of 4 and the apothem of 3.5

answered Apr 4, 2024

1 answer 40.7k views

The typology of Shenhar and Dvir used attributes of technological _____ and project scopes. a) Innovation b) Complexity c) Advancement d) Prowess

asked Mar 4, 2024

1 answer 82.0k views

Acenaphthylene, a hydrocarbon that is a constituent of a coal tar, is 94.71% and has a molar mass of 152.19 g/mol. What are the empirical and molecular formulas of acenaphthylene?

answered Oct 31, 2023

1 answer 198k views

three of the 30 computers are out of service what percent of the computers are working show your work

answered Oct 26, 2023

2 answers 119k views

Which factor aided the growth of settlements in Arkansas Territory? a. decline of cotton agriculture in the south b. abolition of slavery in Missouri c. use of keelboats on the Arkansas River d. popularity

asked Sep 8, 2023

1 answer 230k views

A cross-section of a right triangular prism is created by a plane cut through the points shown and is also perpendicular to the opposite base. What is the most specific name of the shape representing the

answered Aug 21, 2023

1 answer 223k views

Janey paints block of wood with gold glitter for an art project. The block measures 8 inches by 10 inches by 20 inches. after she's done she decides to make two blocks by cutting through the block on the

answered Aug 16, 2023

1 answer 110k views

What is the mean absolute deviation of 1, 2, 2, 3, 5, 6, 6, 8, 8, 9

asked May 19, 2023

1 answer 131k views

En la puerta del sol se encuentra el kilómetro cero de las carreteras españolas.

asked Apr 17, 2023

1 answer 53.8k views

Which aspect of a play would most likely be the same no matter how the play is adapted? A. the plays time period B. the appearance of the plays characters C. the plays themes D. the plays settings

answered Mar 19, 2023

1 answer 21.3k views

(3x-1)^3 binomial cube PLS FAST!!!!

answered Jan 12, 2023

2 answers 2.5k views

describe two ways that the development of Egyptian civilization was influenced by its geographic location.

answered Nov 22, 2022

1 answer 95.5k views

What is the mRNA in TACCGGATGCCAGATCAAATC?

asked Nov 13, 2022

1 answer 173k views

Search QAmmunity.org