Recent activity by Khrm

Recent activity by Khrm

What is added to refined grain products as part of the enrichment process

asked Nov 24, 2024

1 answer 26.4k views

The average annual rainfall in Florida is 55 inches. Is this an example of weather or climate

asked Oct 9, 2024

1 answer 54.9k views

Who accompanies Christian until he is executed in the town of Vanity? A) Hopeful B) Faithful C) Evangelist D) Goodwill

asked Sep 23, 2024

1 answer 150k views

A nurse is teaching a female adult client who is obese about disease management. Which of the following information should the nurse include in the teaching? A: Average body fat for women is 15%. B: Obesity

asked Aug 14, 2024

1 answer 134k views

What is the physiological action of dopamine? A. Stimulates alpha and beta receptors B. Blocks the influx of calcium into a cell C. Oxygenates peripheral tissues D. Blocks the egress of potassium out of

answered Jul 25, 2024

1 answer 28.8k views

Emily uses 4 cups of sugar to make 6 batches of cookies. Michael will follow the same recipe. He will make c batches of cookies using s cups of sugar. Which of these equations represents the relationship

answered Jul 23, 2024

1 answer 151k views

What is E. aerogenes positive for in the IMViC tests?

asked Jul 11, 2024

1 answer 41.7k views

Consider a digital communication binary system where the symbol 0 is transmitted as -3 V and the symbol 1 is transmitted as+3 cyc V/s. During the transmission the signal

answered Jul 10, 2024

2 answers 6.2k views

Which one of these conditions DOES NOT present a potential eye hazard recognized by OSHA? -Toxic gases, vapors, and liquids -Dusts, powders, fumes, and mists -Harsh lighting from industrial lamps -molten

asked Jul 4, 2024

1 answer 194k views

Identify the sum in the form a+bi. (7-3i)+(-14-6i)

asked Jun 27, 2024

1 answer 6.5k views

Sam made a model of the library bell with a base circumference of 8 inches. If the base circumference of the actual library bell is 12 feet, what scale did he use? A. 1:18 B. 1:18.5 C. 1:18.9 D. 1:19.5

asked May 2, 2024

1 answer 199k views

Valuate −8 + 10 × 4 ÷ (−2). Question 25 options: −4 −28 −3 −20

asked Apr 12, 2024

1 answer 192k views

30. A long chain of islands is known as what?

asked Mar 5, 2024

2 answers 145k views

Which of the following descriptions do NOT apply to the thief? A-elderly B-short C-walked with a limp D-had a dog

answered Feb 29, 2024

1 answer 31.2k views

If you wanted to make a double stranded break in the following sequence you would design a 20 base guide RNA sequence. ACGTGATCGATCGTGATCGATCGCAGCTAGCACATCCATCGCATCGATCTGCATCGACGCTAGC Write the 20 base

asked Jan 20, 2024

1 answer 188k views

What angle does an arc 5.5cm in length subtend at the centre of a circle of diameter 7cm

asked Dec 18, 2023

1 answer 46.2k views

Which system of linear inequalities is graphed? A. x<-3 y ≤-x+1 B. x<-3 y ≤-x-1 C. x<-2 y ≤-x-1 D. x ≤-3 y ≤-x-3

asked Dec 13, 2023

1 answer 190k views

18) Solve the problem. 18) y varies directly as x and inversely as the square of z. y = 108 when x = 81 and z = 3. Find y when x = 44 and z = 2 A) 26.07 B) 88 C) 264 D) 132

answered Sep 30, 2023

1 answer 99.2k views

When each area of the country only cared about their specific area and not the needs of the country as a whole

answered Aug 21, 2023

1 answer 142k views

8×138 I got the Answer but I'm not sure (tell if it is true or not ,if not pls tell the answer plsss)

answered Jul 14, 2023

2 answers 194k views

Search QAmmunity.org