Recent activity by Jade Byfield

Question

when was modern psychology recognized by the scientific community and how is it different from other social sciences?

asked Dec 10, 2024

1 answer 43.6k views

Instructions: After reading the literary work "Voices", By Alice Munro, create a concept map containing ideas connected to the story. You can use "linking words" to join the concept together and describe

answered Dec 10, 2024

1 answer 214k views

The secondary of a transformer supplies (1.40x10¹) A to an electric motor. The transformer primary has 350 turns and its secondary has 50 turns. What is the current at the input of the transformer? .

answered Dec 9, 2024

1 answer 199k views

In order to best get information about why a resident didn't eat his or her breakfast, the nursing assistant asks, A) "How are you feeling today?" B) "Did you eat your breakfast today?" C) "Looks like

answered Oct 13, 2024

1 answer 156k views

In the Trigonometric Form of the complex number z=a+bi, what does tanθ=?

answered Jul 6, 2024

1 answer 48.9k views

Calculate the melting temperature of teh following DNA fragments using the sequences only: A. AGTCTGGGACGGCGCGGCAATCGCA B. TCAGACCCTGCCGCGCCGTTAGCGT C. TCAAAAATCGAATATTTGCTTATCTA D. AGTTTTTAGCTTATAAACGAATAGAT

answered Jun 11, 2024

1 answer 206k views

Which of the following is an instant "sobering-up" cure? A. Drinking a lot of coffee. B. Taking a cold shower. C. Eating a heavy meal. D. There are no instant "sobering-up" cures.

asked May 26, 2024

1 answer 3.8k views

List the five elements of Scriptural interpretation.

answered Apr 15, 2024

2 answers 224k views

The source for this longest Chinese river is a glacier high in the mountains A) Yangtze B) Yellow C) Mekong D) Ganges

asked Apr 5, 2024

1 answer 24.0k views

Daniel is employed at two different restaurants. At one restaurant, he makes $5.35 per hour, and at the other, he makes $6.25. Daniel needs to earn $105.30 a week to pay his bills. Describe the number

asked Mar 23, 2024

1 answer 138k views

750 divided by 1/4ths

answered Feb 27, 2024

1 answer 24.4k views

The local florist never has more than a combined total of 40 daisy bouquets and carnation bouquets, and she never has more than 12 carnation bouquets. Write a system of inequalities that represents this

asked Jan 25, 2024

1 answer 124k views

The figure provided below consists of two graphs. In the first paragraph, you are supposed to write a descriptive paragraph about ONE visual of your choice. In the second paragraph, you are supposed to

asked Jan 24, 2024

1 answer 34.6k views

API Publication 2201 on hot tapping and in-service welding covers: A) Welding requirements B) technical aspects C) Inspection requirements D) Safety aspects

answered Jan 13, 2024

1 answer 42.3k views

A box weighing 2000 n is sliding across a cement floor. The force pushing the box is 500 n and the coefficient of sliding friction between the box and the floor is 0. 20. What is the acceleration of the

answered Dec 18, 2023

1 answer 154k views

Translate: the desk (in a classroom) Ola mochila el pupitre o la mesa de trabajo el aula el horario

asked Sep 26, 2023

2 answers 35.8k views

Which shows the formula for converting from kelvins to degrees Celsius? °C = (9/5 x K) +32 °C = 5/9 x (K - 32) °C = K - 273 °C = K + 273

answered Sep 7, 2023

2 answers 127k views

Bsr heu ,Dans vendredi ou la vie sauvage comment. Robinson se procure de la nourriture

asked Jul 25, 2023

2 answers 58.5k views

A middle school took all of its 6th grade students on a field trip to see a symphony at a theater that has 2600 seats. The students left 806 seats vacant. What percentage of the seats in the theater were

asked Jun 22, 2023

2 answers 141k views

What expression is equivalent to (4x–5) (2x-3)?

answered Mar 12, 2023

2 answers 19.3k views

Ask a Question