Recent activity by Famargar

Recent activity by Famargar

b) Edward and Thomas share some money in the ratio 2:3 Thomas receives £243. How much does each Robert receive?

answered Oct 25, 2024

2 answers 85.4k views

Does molecular weight have units?

answered Aug 19, 2024

1 answer 185k views

What is DNA cloning?

asked Aug 3, 2024

1 answer 142k views

Did most Oregon Trail pioneers settle in Oregon? 1) True 2) False

answered Mar 28, 2024

1 answer 28.4k views

Consider this DNA sequence: TTCGAATTCGACTCAGGATCCTACAAGTTTGAT AAGCTTAAGCTGAGTCCTAGGATGTTCAAACTA Which of the following restriction sites are present in this sequence? 1) EcoRI 2) HindIII 3) BamHI 4) NotI

answered Mar 25, 2024

1 answer 123k views

Whats a opening strategy

answered Jan 15, 2024

2 answers 88.0k views

A square patio has a perimeter of (8x +28) feet. What is the length of the patio

answered Dec 7, 2023

1 answer 141k views

When protein is consumed, the body breaks it down into smaller molecules known as:.

asked Nov 8, 2023

1 answer 98.7k views

Why can the First World War be considered the determining event of the twentieth century? How and why did the First World War develop into a total war for systemic survival between the great powers?

answered Oct 29, 2023

1 answer 232k views

What are 2 benefits of nuclear power? A disadvantage?

asked Oct 16, 2023

2 answers 228k views

Use the distance formula to find the distance, to the nearest tenth, from S(7, −1) to V(−1, 3). A.2.5 units B.0.0 units C.8.9 units D.−4.0 units

asked Aug 7, 2023

1 answer 187k views

What three factors determine a person skin color?

answered Aug 1, 2023

1 answer 189k views

What is the difference between a relation and function? Classify each of the following as a function, or not a function. State the domain and range {(1,7),(1,14),(1,21)} The relation is/isn't a function

asked Jun 15, 2023

1 answer 63.6k views

Refer to photo , there are seven questions .

answered May 13, 2023

1 answer 114k views

Based on the tone of the poem, the speaker would most likely describe the Arctic setting as A. paradise B. darkly captivating C. evil D. pure and honest

answered Apr 13, 2023

2 answers 69.3k views

An object is moving at a velocity of 30 m/s. It accelerates to a velocity of 55 m/s over a time of 12.5 s. What acceleration did it experience? v = vo + at

asked Apr 4, 2023

1 answer 122k views

Solve each triangle for the missing values shown. Show all work necessary. Use exact values

answered Nov 9, 2022

1 answer 231k views

-Comment la vieille femme apparaît elle dans ce récit ? Par quels procédés ? Quelle relation s'établit entre Lise et Véronique tout au long du récit ?

asked Nov 7, 2022

1 answer 235k views

Write the advantages of federal government Long answer please.

answered Nov 1, 2022

1 answer 141k views

Maddison hid 12 of her sister's birthday gifts around the house. If this was 15% of the gifts, how many total gifts did her sister have?

answered Sep 1, 2022

2 answers 80.1k views

Search QAmmunity.org