123k views
2 votes
Consider this DNA sequence: TTCGAATTCGACTCAGGATCCTACAAGTTTGAT AAGCTTAAGCTGAGTCCTAGGATGTTCAAACTA Which of the following restriction sites are present in this sequence?

1) EcoRI
2) HindIII
3) BamHI
4) NotI

1 Answer

7 votes

Final answer:

The DNA sequence presented contains the restriction site for EcoRI, which is recognized by the sequence GAATTC. There are no sequences matching HindIII or BamHI within the provided DNA, and NotI cannot be determined without its specific recognition sequence. Option 1 is the correct answer.

Step-by-step explanation:

The student has asked to identify which restriction sites are present in a given DNA sequence from the options provided: EcoRI, HindIII, BamHI, and NotI. Each of these restriction enzymes recognizes specific nucleotide sequences and cuts the DNA at these sites.

A palindromic sequence is often characteristic of restriction sites, meaning the sequence reads the same in the 5' to 3' direction on both DNA strands. After reviewing the provided DNA sequence, one can look for these specific palindromic sequences to determine the presence of restriction sites.

EcoRI recognizes the sequence GAATTC and would cut between G and A on one strand and between C and T on the complementary strand, creating sticky ends. The given DNA sequence contains GAATTC, thus the EcoRI site is present. HindIII recognizes the sequence AAGCTT and cuts between A and A, also creating sticky ends. However, there is no AAGCTT sequence in the given DNA.

BamHI recognizes the sequence GGATCC and cuts between G and G, creating sticky ends as well, but this sequence does not appear in the given DNA either. Lastly, NotI cuts a longer recognition sequence that is not provided, so its presence cannot be determined from the given information without knowing its specific recognition sequence.

Therefore, based on the given information and sequence provided, it is clear that the restriction site present in the DNA sequence is EcoRI. This is the correct option answer in the final answer.

User Famargar
by
8.0k points