Recent activity by Eugene Yokota

Recent activity by Eugene Yokota

Which ordered pair is a solution of 6X + 7 < 21

asked Dec 16, 2023

1 answer 4.8k views

Can someone please help me? :(

asked Dec 15, 2023

1 answer 78.5k views

Showstoppers refer to A) creative or innovative members of a marketing team. B) unexpected alternative uses for a product that result in a sudden increase in sales. C) a situation when a competitor's product

asked Oct 25, 2023

1 answer 101k views

HELP Which equation does the graph below represent? (1 point) A coordinate grid is shown. The x-axis values are from negative 5 to positive 5 in increments of 1 for each grid line, and the y-axis values

asked Aug 5, 2023

1 answer 158k views

Solving systems by substitution y=x+3 2x-2y = -6

answered Jun 18, 2023

2 answers 170k views

I NEED HELP PLEASE MATH MATH MATH

asked May 13, 2023

2 answers 99.9k views

How i can impress a boy ?

asked May 9, 2023

1 answer 199k views

If a one-person household spends an average of $52 per week on groceries, find the maximum and minimum amounts spent per week for the middle 50% of one-person households. Assume the standard deviation

asked Apr 21, 2023

1 answer 233k views

How many senate votes are required to confirm a supreme court justice.

asked Jan 28, 2023

1 answer 63.0k views

What is the opportunity cost to john of saving at age 18? What did he give up? (hint there is no single right answer, you have to think "what might john have given up?")

answered Dec 15, 2022

1 answer 180k views

Nina and Luca were told to draw a net for the three-dimensional figure shown below. Which statement nets is true? Three-dimensional Figure

asked Nov 25, 2022

1 answer 121k views

A conservationist would most likely want to do which of the following to the land pictured? OA. Preserve the habitat. OB. Develop a master plan to determine the land's future use. Ос. Use parts of it for

answered Nov 23, 2022

2 answers 187k views

A local town has a problem with too many mice running around. In response to this they start a war on the mice, and get neighboring communities to join them. As a result, all of the mice for 40 square

answered Nov 14, 2022

1 answer 230k views

Given g(h)=-x-4, find g(5)

asked Oct 22, 2022

1 answer 86.9k views

Determine the value of the variable from the image below.

asked Oct 20, 2022

1 answer 172k views

Which of the following is an example of an internal conflict brandon competes Brandon competes against 100 other actors for a roll in a movie Audrey fights her fear of height places to become a zipline

asked Oct 5, 2022

2 answers 148k views

What vascular tissue transported these carbohydrates?

asked Aug 4, 2022

2 answers 120k views

Can solute particles pass through the membrane of a semipermeable membrane?

answered Jul 31, 2022

2 answers 123k views

Which structures should a student bond together to form two strands when building a DNA model? * A. Ribosomes B. Phosphates C. lysosomes D. Nucleotides

answered Jul 22, 2022

1 answer 199k views

Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provide the 6 DNA codons that would be read following

answered May 22, 2022

1 answer 10.2k views

Search QAmmunity.org