Recent activity by Codmitu

Recent activity by Codmitu

Dear Sir or Madam: I am responding to your advertisement seeking administrative assistants. I feel I am highly qualified for the position and have a great deal of relevant experience. I am hardworking,

answered Aug 2, 2024

2 answers 164k views

_______________________ is the combination of self-confidence and self-respect. Group of answer choices Body image self-perception Self-esteem personality

answered Sep 8, 2023

2 answers 97.7k views

Pls help me with this god bless you

answered Aug 15, 2023

1 answer 29.4k views

What is the gravitational potential energy of a diver-Earth system, if the diver has a mass of 75-kg and is 5.0 m above the reference level?

answered Jul 28, 2023

1 answer 81.0k views

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.b) Circle the starter and the stopper in

asked Jun 6, 2023

1 answer 4.3k views

jack wants to ask his biology teacher for her office phone number. how should he phrase the question?

answered Apr 26, 2023

2 answers 157k views

What is 1-1/3 pls help me

asked Apr 10, 2023

1 answer 951 views

using the table, calculate the effective federal income tax rate for a married couple with two children who make a combined income of $45,650.A.) 7.4%B.) 3.9%C.) 5.2%

asked Apr 8, 2023

1 answer 216k views

Find 0 in degrees. ?] degrees Round to the nearest hundredth

answered Mar 25, 2023

2 answers 194k views

A quoi cert un mythe?

asked Mar 16, 2023

1 answer 151k views

Could you help with this please? It would get my grade up and i'd get my stuff back.

answered Jan 1, 2023

2 answers 111k views

Determine the length, or distance, Meredith runs in 1 minutes. Meredith runs at a rate of 101 meters per minute. Use the formula d = r × t to find how far she runs in 1 minutes. Meredith runs ? meters

answered Dec 26, 2022

2 answers 208k views

Find the area of the triangle. Round your answer to the nearest tenth. B 37 cm 410 А 37 cm с a. 449.1 cm2 b. 684.5 cm C. 898.1 cm2 d. 595 cm

asked Dec 15, 2022

1 answer 157k views

The lymphatic system helps to remove bacteria and other microorganisms from the body. Why would this be important to you?

answered Nov 15, 2022

1 answer 172k views

TEST - chapter 8 32 of 32 POSSIBLE POINTS: 3 What are the three factors that affect the rate of photosynthesis? (Hint: These are clearly listed toward the end of your notes).

asked Nov 5, 2022

1 answer 114k views

Temperature and rainfall affect A. herding traditions in the Andes B. wind patterns in the Caribbean C. the tree line and snow line D. what crops people can grow

asked Oct 24, 2022

1 answer 100k views

Help me quick please I can’t see link so real people answer this

asked Oct 23, 2022

1 answer 7.8k views

NECESITAR | to need yo nosotros tú I vosotros él ellos ella ellas usted ustedes

answered Oct 17, 2022

2 answers 109k views

10. Does the mapping represent a function? Input Output -8 F-8 -2 -6 N 00 A. Yes B. No

answered Sep 20, 2022

1 answer 202k views

What type of kingdom was thought to be established by the Taiping rebellion

answered Sep 18, 2022

2 answers 166k views

Search QAmmunity.org