Recent activity by Chrskly

Recent activity by Chrskly

The ATP synthase of cellular respiration makes ATP by taking H+ ions from ____ space?a) thylakoid space (inside)b) cytoplasmc) outer mitochondrial membraned) inner mitochondrial membranee) stromaf) mitochondrial

answered Nov 21, 2023

1 answer 116k views

The word root of unfriendly is OA. end OB. friend O C. unfriend OD. friendly

asked Nov 17, 2023

2 answers 55.8k views

Situation:A farmer in China discovers a mammalhide that contains 57% of its originalamount of C-14.N = Noe-ktNo inital amount of C-14 (at time=t = 0)N= amount of C-14 at time tk= 0.0001t = time, in yearsFind

asked Nov 7, 2023

1 answer 14.9k views

I need to know how to do this

asked Sep 1, 2023

1 answer 128k views

What is somatic and germline mutation?

asked May 24, 2023

1 answer 216k views

What is the difference between gross & net pay

asked May 5, 2023

1 answer 78.5k views

Who was the other survivor in the May 13, 1985 police bombing?

answered Apr 7, 2023

1 answer 167k views

Can someone pls help me I’m stuck on this problem and this is due tomorrow!

answered Mar 31, 2023

2 answers 44.3k views

Is "we hadn't had" gramatically correct?

asked Mar 8, 2023

1 answer 150k views

What are the steps of middle distance running?

answered Jan 17, 2023

2 answers 115k views

Write down in terms of n,an expression for the Nth term of the following sequences. A) 2,5,8,11,14 B) 9,11,13,15,17

answered Dec 27, 2022

2 answers 6.4k views

Capital city birth painter who contributed to science. A work of fame. this work became the focus of discussions after years The work gained fame in the exhibition held in Germany and Switzerland. What

answered Dec 22, 2022

1 answer 102k views

Do it in passive 1 They will give you the answer sheet and you are to write your name at the top of this sheet. =The answer ..................................... 2People believed that witches from nearby

answered Nov 19, 2022

1 answer 25.9k views

If a firm produced a product that was experiencing growth in demand, the smoothing constant alpha (reaction rate to differences) used in an exponential smoothing forecasting model would tend to be which

asked Sep 18, 2022

1 answer 168k views

Common coagulants (salts) used in conventional water treatment include the following alum (aluminum sulfate), sodium aluminate, ferric sulfate, ferrous sulfate, ferric chloride, and polymers. Question

answered Jul 27, 2022

1 answer 51.1k views

Why did Russia join World War 1?

answered Jul 21, 2022

2 answers 224k views

Solve for x:30/x = 5

asked Jun 9, 2022

2 answers 77.3k views

On June 30, 2009, Apricot Co. paid $5,000 cash for management services to be performed over a two-year period. Apricot follows a policy of recording all prepaid expenses to asset accounts at the time of

answered May 19, 2022

1 answer 4.2k views

Why do equivalent ratios form a straight line when graphed? The vertical distance between points is constant, and the horizontal distance between points increases with each point. The ratio of the change

answered Apr 15, 2022

2 answers 37.2k views

Use the restriction enzyme EcoRi to cut DNAVictim DNA : GGAAG ATTCTACATTACTGACGGACGTGACGTGA CCTTCTTAA GATGTAATGACTGCCTGCACTGACT Number of restriction fragments ( pieces of DNA after digestion) : Size of

asked Mar 25, 2022

1 answer 98.6k views

Search QAmmunity.org