Recent activity by Cherylyn

Question

What are some special considerations for long-term positioning?

asked Oct 14, 2024

1 answer 196k views

Record 3 phrases or statements that Milton makes to appeal to the jury's sympathy for Kya?

answered Sep 18, 2024

2 answers 115k views

French military leader that helped Washington and the Continental Army? John Locke Marquis de Lafayette Samuel de Champlain Charles Montesquieu

answered Aug 16, 2024

1 answer 208k views

The spectrum of a type Ia supernova can be identified because it lacks evidence of

answered Jul 29, 2024

1 answer 21.4k views

Which of the following terms refers to the act of differentiating a brand in a consumer's mind in relations to the brand's competitors? A) Targeting B) Segmentation C) Brand building D) Differentiated

answered Jul 24, 2024

1 answer 90.5k views

What rights, enjoyed by Barbadian citizens, should Mary and her children be given by the Barbados government? A. All rights except voting. B. All rights except property ownership. C. All rights, including

answered Jul 6, 2024

1 answer 124k views

Any breaks in the chain of custody could result in the loss of cases in court?

asked Jun 21, 2024

1 answer 139k views

Which of the following statements regarding the current classification of overweight and obesity is true? A. Obesity is defined as a body mass index (BMI) > 25 kg/m2 and morbid obesity is defined as a

answered Jun 16, 2024

1 answer 63.0k views

Exercise 1: 1) Suppose we have to select a manager, assistant manager, and night manager from a list of 11 people. How many ways can this be done

answered May 14, 2024

1 answer 217k views

Percy Jackson Who owns the yankees baseball cap?

answered May 1, 2024

2 answers 93.3k views

In their Principles of Financial Accounting class, Batini has been studying the Sarbanes-Oxley Act. Which of the following is not a key component of the act? O Accounting firms are prohibited from providing

asked Apr 6, 2024

1 answer 131k views

Graph the pair of equations on the same axes. x=5 y=-7

asked Feb 19, 2024

1 answer 91.8k views

You hired a contractor to update electrical wiring in your house. After the work, the outlets in your kitchen all shorted out. The contractor refused to return to do the work without additional payment.

answered Feb 9, 2024

1 answer 169k views

A principal in a school with a history of low performance is preparing to interview candidates for an open position in the English department. The principal is considering various prompts that could be

asked Jan 18, 2024

1 answer 108k views

If the DNA sequence 3’ GTTACAGCACAGGGTAAACTC 5’ is mutated to 3’ GTTACAGCACAGGGTAAACGC 5', what does it do to the protein produced?

asked Jan 16, 2024

1 answer 183k views

If x and y are in direct proportion and y is 36 when xx is 9, find y when xx is 8.

asked Jan 12, 2024

1 answer 138k views

A car accelerates from an initial velocity of vi=20 m/s to a final velocity of bc=35 m/s in a time interval of 5 s find avarage acceleration

answered Dec 29, 2023

1 answer 64.9k views

3. We become ill…… a) if we would had known b)if we go to the dentist c) if we eat dirty food 4. If I do this test,I……. a) Won't give b) Will improve c) Will give 5. If I came earlier, I…….dinner a) will

asked Dec 14, 2023

1 answer 151k views

Yolanda is buying supplies for school. She buys n packages of pencils at $1.10 per package and m pass of paper at $2.40 each. What does each term in the expression 1.1n + 2.4m represent? What does the

answered Oct 6, 2023

1 answer 228k views

Steven has $10. Each week he earns $2. Show how much money he will have at the end of 10 weeks. How many weeks will it take until he has $25?

asked Oct 4, 2023

2 answers 58.1k views

Ask a Question