Recent activity by Cadavre

Recent activity by Cadavre

If you can solve this I will give you 100 points! 3x+1

answered Dec 21, 2023

2 answers 171k views

I’ll buy you an ice cream cone when we get there

answered Nov 15, 2023

2 answers 174k views

How many liters of carbon dioxide gas are there in 4 moles of CO2 at STP?

asked Aug 7, 2023

1 answer 48.0k views

I am confused on my geometry test review and need help.

asked Aug 5, 2023

1 answer 198k views

Quelqu'un peut m'aider?

asked Jun 12, 2023

1 answer 52.9k views

Let him answer the question (into passive voice)

asked May 13, 2023

1 answer 184k views

Information about computer

answered Apr 28, 2023

1 answer 195k views

At a certain movie theater, the ratio of length to width of the movie screen is 16: 9. If the length of thescreen is 90 feet, then, to the nearest foot, how many feet is its width?

answered Apr 14, 2023

1 answer 97.2k views

Please Help Thank you! ^^

answered Jan 24, 2023

2 answers 208k views

A box that has a width of 3 inches and a length of 4 inches is used to ship a part. The part lies along the diagonal of the bottom of the box. What is the longest possible length of the part? 3 in 4 in

answered Dec 26, 2022

1 answer 180k views

Sergio bought 3 different pizzas. He ate 1/4 slices of each pizza. How much of the pizzas did he eat altogether?

answered Nov 20, 2022

2 answers 221k views

TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA

answered Nov 1, 2022

1 answer 86.1k views

Solve 2x-3=-4 solution to the system

asked Oct 18, 2022

2 answers 203k views

A 2kg ball is attached to a 0.80m string and whirled in a horizontal circle at a constant speed of 6m/s .the work done on the ball during each revolution is.

asked Oct 13, 2022

1 answer 36.6k views

Level 2 Question 12 8x^5-8x^3+x^2-1

answered Oct 8, 2022

1 answer 9.2k views

PLEASE HELP NO LINKS

asked Sep 22, 2022

1 answer 4.8k views

What is orange? A. a color B. A fruit?

answered Aug 29, 2022

2 answers 67.5k views

Describe the slope of the line with the equation y = -4x + 10. A: positive slope B: negative slope C: zero D: undefined

asked Aug 3, 2022

1 answer 110k views

HELP ASAPPP PLEASEEEEEEEE... NO FAKE ANSWERS OR LINK

answered May 4, 2022

2 answers 182k views

Define terms organic molecules and inorganic molecules

answered Apr 7, 2022

2 answers 217k views

Search QAmmunity.org