Recent activity by Babblo

Question

Huda wants to buy soda. A 12-pack costs $9.50. She knows that with the local sales tax of $2.00, the total should be $11.50. However, when she gets to the checkout, the total is now $13.00. Which type

asked Dec 9, 2023

1 answer 33.8k views

Can bras increase pectoral muscle atrophy? How? Why?

answered Dec 9, 2023

1 answer 155k views

Describe how the writers of ""into the air"" and ""the wright brothers"" show that orville and wilbur worked together to overcome obstacles. cite evidence from both texts to support your answer.

answered Nov 7, 2023

1 answer 124k views

I need a little help with this, I graphed it but I'mstill stuck.

asked Oct 24, 2023

1 answer 48.2k views

Ella practices piano for 45 minutes. She spends m minutes longer working on homework than she does practicing the pianos.Create an expression that shows how many minutes ella spends working on her homework.

asked Sep 16, 2023

1 answer 156k views

Find true square numbers that add to 125.There are two ways to do this. Please tell me those two ways!

answered May 30, 2023

1 answer 182k views

Question 2 of 9 Use the scale to help you solve the equation and find the value of x. Enter the value of x below. Y x+2=7 X =______

answered Feb 10, 2023

2 answers 138k views

Translate to preterite tense We were happy You wanted to go The girls set the table He could go We knew She wanted to know He knew We put

answered Jan 13, 2023

2 answers 170k views

How did Benjamin react to his brother’s confinement?

asked Jan 2, 2023

1 answer 8.7k views

Write the code for RNA from this DNA STRAND : AAAAAATTTTTTCCCGGGGTTTATATATC

answered Dec 19, 2022

1 answer 196k views

3. How can changes to the structure of DNA lead to the development of new traits in a species?

answered Nov 9, 2022

2 answers 205k views

Do you consider Nick Naylor to be an immoral person because he chooses to work as a tobacco lobbyist? Why or why not? Give specific examples from the movie.

asked Nov 8, 2022

1 answer 186k views

PLEASE HELP FAST!!!!! Read the excerpt from Act I of Julius Caesar. "Announcer 2: A month later, the night before the ides of March, all of Rome is frightened by a terrible earthquake and storm. Announcer

answered Nov 5, 2022

2 answers 75.7k views

CALCULUS: Which of the following represents the volume of the solid formed by revolving the region bounded by the graphs of y =x^(3), y = 1, and x = 3, about the line x = 3? A. π * [27,1]∫ (3-∛y)² dy B.

answered Sep 30, 2022

2 answers 208k views

Ano ang kahalagahan ng kuwago

answered Sep 14, 2022

2 answers 22.6k views

بم تفسر؟ 2- التفات أنظار الدول ومنهم دولة الإمارات العربية المتحدة إلى تنويع مصادر الطاقة وعدم الإعتماد على الطاقة الغير متجددة فقط؟ Helpppp

asked Aug 6, 2022

1 answer 111k views

Which word is the best synonym for cultured? A. impulsive B. well-mannered C. wealthy D.well-known

asked Aug 3, 2022

1 answer 97.7k views

One number added to twice another number is 30. The sum of the numbers is 19. Write and solve a system of equations to represent this situation. What is the value of the smaller number? What is the value

answered Jun 27, 2022

1 answer 101k views

A triangular piece of wood is being installed on a front porch. The piece of wood is shown below. Find its area. Round to the nearest tenths place.

asked Apr 18, 2022

1 answer 175k views

Together Mrs.Valencia and Mr.Brennan have $370. Mrs.Valencia has $50 more than 3 times the amount of money Mr.Brennan has. How much does each person have?

answered Apr 11, 2022

2 answers 42.0k views

Ask a Question