Recent activity by Ade Yahya

Recent activity by Ade Yahya

Solve the following quadratic by completing the square.

answered Jan 3, 2024

1 answer 18.5k views

I'm stuck on this problem I need help thank you

answered Dec 22, 2023

1 answer 226k views

Which table represents a relation with a domain of {-1, 2} and a range of {3, 5}

answered Nov 16, 2023

2 answers 9.2k views

If your instructor were to ask if you cleaned up your room before leaving the house, she would be acting outside of her?

asked Sep 17, 2023

1 answer 22.5k views

How long does light from jupiter take to reach earth.

answered Sep 9, 2023

1 answer 78.1k views

Solve 6|y| + 6 = 4 answers: 0 {-6,4} {-4,4} {0}

asked Aug 22, 2023

1 answer 81.8k views

Explain the steps you would use to solve this equation. Find the solution. 8^2z=4096

asked Jul 16, 2023

1 answer 80.7k views

Easy! 40 PTS!!! Log Functions

answered May 19, 2023

1 answer 41.5k views

Which of the following square roots would not be between 7 and 8 A √50 B √62 D) √ 45 C) √53

answered Jan 16, 2023

2 answers 165k views

which possible mutation of the DNA triplet GAC will affect the production of a protein by the gene that contains this triplet

asked Jan 5, 2023

1 answer 211k views

Crane Company provided the following information on selected transactions during 2021: Purchase of land by issuing bonds $950000 Proceeds from issuing bonds 3020000 Purchases of inventory 3870000 Purchases

answered Dec 17, 2022

1 answer 164k views

How did industrialization change the way people thought about the world?

asked Dec 3, 2022

1 answer 32.2k views

Is 1.21221222 a rational number

answered Nov 19, 2022

2 answers 103k views

How will you know if the equation opens vertically or horizontally?

answered Nov 19, 2022

2 answers 15.2k views

Popular mixed drinks such as margaritas contain more alcohol than a standard drink. A. will B. do not necessarily O C. never Drugs the chemistry of the brain and the way that a person thinks. A. change

asked Nov 15, 2022

2 answers 132k views

Malika knows that 230 - 39 = 191. How can she use that to help her solve 233 - 42 = ? Use the space and/or the lines below to answer.

answered Nov 10, 2022

2 answers 4.0k views

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein

asked Oct 13, 2022

1 answer 173k views

Help plzz hi help plzzz

answered Oct 13, 2022

1 answer 159k views

Help plzz hi help plzzz

answered Oct 13, 2022

1 answer 159k views

Help plzz hi help plzzz

answered Oct 13, 2022

1 answer 159k views

Search QAmmunity.org