Answers by Abalos
Register

Answers by Abalos

Answers by Abalos
Filter
5. What is the value of p in the equation? p - 4 = -8 -2 -12 -4 - 32
answered Nov 19, 2023
16 votes
264k views
In the diagram, MN is parallel to KL. What is the length of MN? K M 24 cm 6 cm 2 12 cm L O A. 6 cm O B. 18 cm O c. 12 cm D. 8 cm
answered Oct 28, 2023
19 votes
44.3k views
Is this statement true or false: a - b = b - a True False
answered Oct 18, 2022
21 votes
454k views
Two stores have competing back-to-school sale. Which store offers the better price per T-shirt? What is the price? Explain.
answered Aug 9, 2022
21 votes
167k views
PLZZ HELP I NEED HELP write a 2 step equation and solve: 1. four more than six times a number is 22. 2. five less than eleven times a number is 50. 3. seven less than nine times a number is -16.
answered May 30, 2022
13 votes
135k views
How did Mali promote the spread of Islam in Africa? A. Its leader went on an two-year trip to Mecca, ОО B. Its capital was moved to the Arabian Peninsula. u C. Its trade routes were open only to other
answered Mar 28, 2022
18 votes
279k views
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT
answered Mar 9, 2022
9 votes
24.7k views
Ask a Question
Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.

1.6m questions

2.0m answers

Other Questions

Can anybody tell me what’s going on here?
Which sediment has the greatest permeability?
Biological Molecules
This is referring to the Crucible: What is the dispute between John Proctor and Thomas Putnam? What does this dispute foreshadow? Please and thank you!
Granola costs $1.76 per pound. Write and solve an equation to determine the number of pounds p of granola that can be purchased with $7.04. The equation is: The value of x is