Recent activity by Abalos

Recent activity by Abalos

5. What is the value of p in the equation? p - 4 = -8 -2 -12 -4 - 32

answered Nov 19, 2023

2 answers 264k views

In the diagram, MN is parallel to KL. What is the length of MN? K M 24 cm 6 cm 2 12 cm L O A. 6 cm O B. 18 cm O c. 12 cm D. 8 cm

answered Oct 28, 2023

1 answer 44.3k views

Please help due rlly soon I need help on the third one which is c) please help me

asked Oct 9, 2023

1 answer 343k views

Which expression gives 0? * 1 point A. 12 + (4 x 0) B. 12 ÷ (4 + 0) C. (12 x 4) + 0 D. (12 + 4) x 0

asked Sep 16, 2023

1 answer 44.2k views

"one-third of a number is 12 less than the number itself" translate as an equation not solved

asked Aug 28, 2023

1 answer 169k views

Which of the following statements best describes the development of the child character over the course of Nature?

asked May 17, 2023

1 answer 355k views

What is the Atomic Mass / Weight for silver? *Round your answer to the nearest whole number

asked Mar 11, 2023

1 answer 303k views

I’m confused about this and the other answer is the 1.7 in the trial one

asked Feb 15, 2023

1 answer 486k views

Last Halloween, Nathaniel and his sister each collected160 pieces of candy.a. Nathaniel ate 25% of his candy. How many pieces ofcandy did he eat?

asked Jan 12, 2023

1 answer 401k views

Is this statement true or false: a - b = b - a True False

answered Oct 18, 2022

2 answers 454k views

Two stores have competing back-to-school sale. Which store offers the better price per T-shirt? What is the price? Explain.

answered Aug 9, 2022

1 answer 167k views

PLZZ HELP I NEED HELP write a 2 step equation and solve: 1. four more than six times a number is 22. 2. five less than eleven times a number is 50. 3. seven less than nine times a number is -16.

answered May 30, 2022

1 answer 135k views

How did Mali promote the spread of Islam in Africa? A. Its leader went on an two-year trip to Mecca, ОО B. Its capital was moved to the Arabian Peninsula. u C. Its trade routes were open only to other

answered Mar 28, 2022

2 answers 279k views

How the inner ear is responsible for feeling dizzy?

asked Mar 17, 2022

2 answers 314k views

How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT

answered Mar 9, 2022

1 answer 24.7k views

2. $500 is earning 8% simple interest for 6 months. What is the interest earned? The principal is The rate is The time in years is I = prt The interest earned is

asked Feb 8, 2022

1 answer 398k views

Search QAmmunity.org