Register
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
54.9k views
3 votes
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A

User Aryo
by
6.5k points

1 Answer

7 votes

GTTCAAGCTACTGTTCAAGCTACT

User Nilobarp
by
6.5k points
Ask a Question
Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.

7.2m questions

9.6m answers

Other Questions

Which of the objects is living or nonliving: Bacteria, virus, moss, you, a lemon seed, the air, bread, lettuce and rocks?
Why aren't all minerals gemstones?
What are three important types of forces
How can paleontologists help us understand the past
What is the phenotype of a heterozygous person using T for tall and t for short
Link Copied!