Register
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
54.9k views
3 votes
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A

User Aryo
by
4.9k points

1 Answer

7 votes

GTTCAAGCTACTGTTCAAGCTACT

User Nilobarp
by
5.1k points
Ask a Question
Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.

5.4m questions

7.0m answers

Other Questions

Analysis Questions: 1. List five observations Darwin made about the Amblyrhynchus lizards. 2. Describe two examples of structural adaptations that Darwin observed. 3. Describe two behavioral adaptations
A muscle group that works with and assists the action of a prime mover is a(n) ________. a muscle group that works with and assists the action of a prime mover is a(n) ________. antagonist and fixator
The light that humans can perceive with the eye is _______ light. A:Ultraviolet B:infrared C:Visible D:Gamma
Flexor and extensor muscles work _______ to operate the joint.
Explain why disversity in organisms is important and discuss what might happen if there is a lack of diversity in organisms
Link Copied!