Register
Create the complement of the following DNA strand. TACCCATTACGCGGCAAGCGUAATTAC​
54.1k views
3 votes
Create the complement of the following DNA strand. TACCCATTACGCGGCAAGCGUAATTAC​

User Nico Andrade
by
4.9k points

2 Answers

2 votes
AUGGGUAAUGCGCCGUUCGCAUUAAUG
User Neal Fultz
by
4.9k points
5 votes

Answer:

This is the mRNA strand

Step-by-step explanation:

AUGGGUAAUGCGCCUUCGCAUUAAUG

User Athanassis
by
5.8k points
Ask a Question
Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.

5.3m questions

6.9m answers

Other Questions

An example of the interaction of the nervous and endocrine systems can be seen in our response to danger. The _______________ orders the adrenal glands to release the hormones epinephrine and norepinephrine,
When an individual stops breathing, brain cells die very quickly, but the cells in the heart are able to survive for longer. Which conclusion is best supported by these facts?
1. Nutrients move from the digestive system into the blood by traveling through ___________, tiny tubes sticking out of the wall of the small intestine. 2. In the body's excretory system, urea and water
Greg has been given a small sample of metal. His teacher has assigned him to identify what type of metal he was given. Which of the following is a physical property that will help Greg to identify the
When smaller molecules are bonded together to create larger ones, the smaller molecules are called _and the larger molecules that they build are called​
Link Copied!