Question

You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAGCTTAATCGGGCTAT 3'. In order to determine if this sequence might be within the coding region of a gene, you examine it for open reading frames. How many open reading frames exist that go all the way through this DNA fragment? (Recall that the stop codons are 5' TAA, 5' TAG, and 5' TGA.)

Answer 1

There is 1 open reading frame that goes all the way through this DNA fragment.

Step-by-step explanation:

To determine the number of open reading frames (ORFs) that go all the way through the DNA fragment, we need to identify all possible start and stop codons within the sequence. The start codon is AUG, which codes for the amino acid methionine. The stop codons are UAG, UGA, and UAA, which do not code for any amino acids. By finding all instances of a start codon followed by one of the stop codons that occur after it, we can identify the ORFs that go all the way through the DNA fragment.

In the given sequence, there is only one start codon (AUG) and one stop codon (UAA) that occur after it. Therefore, there is 1 open reading frame that goes all the way through this DNA fragment.

It's important to note that this analysis does not take into consideration any potential frame shifts or alternative reading frames that may exist in the larger human genome.