Register
A restriction enzyme is coded for: AT!GC How long would the Base Pair fragments be for this DNA sequence? AGTCGAGTATATGCATGGCCGCGAT 1)25 and 0 2)25 and 25 3)14 and 11 4)12 and 13
204k views
3 votes
A restriction enzyme is coded for: AT!GC

How long would the Base Pair fragments be for this DNA sequence?

AGTCGAGTATATGCATGGCCGCGAT

1)25 and 0
2)25 and 25
3)14 and 11
4)12 and 13

User Shersha Fn
by
5.0k points

1 Answer

3 votes

Answer: The answer is 4) 12 and 13

Explanation: you count the A and T together, which is 12. Then you count the G and C together, which is 13. I just took a test with this question and got it correct

User Rowwingman
by
5.0k points
Ask a Question
Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.

5.7m questions

7.4m answers

Other Questions

Which of these structures is primarily responsible for the enzymatic breakdown of a large molecules in the cell?
What are some common signs and symptoms of mental health disorders?
Which statement BEST describes the relationship between adenosine diphosphate (ADP) and adenosine triphosphate (ATP)? A. With an input of energy, ADP rearranges to become ATP. B. Without any energy change,
A state of joyful activity in which the subject performs an action effortlessly and skillfully is known as a(n) __________.
!! Earth Science!! Carbon dioxide is normally approximately 2% fraction of the air in the atmosphere. The reason carbon dioxide is considered a pollutant is because... a) Carbon dioxide levels are much
Link Copied!