204k views
3 votes
A restriction enzyme is coded for: AT!GC

How long would the Base Pair fragments be for this DNA sequence?

AGTCGAGTATATGCATGGCCGCGAT

1)25 and 0
2)25 and 25
3)14 and 11
4)12 and 13

User Shersha Fn
by
7.3k points

1 Answer

3 votes

Answer: The answer is 4) 12 and 13

Explanation: you count the A and T together, which is 12. Then you count the G and C together, which is 13. I just took a test with this question and got it correct

User Rowwingman
by
8.2k points
Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.