What is the mRNA that would be transcribed from this strand of DNA?

asked Aug 11, 2023 214k views

5 votes

4.8k points

Please log in or register to add a comment.

6 votes

Answer:

AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication

Step-by-step explanation:

Leonardo Wildt answered Aug 15, 2023

4.3k points

Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.

4.5m questions

5.9m answers