Register
What is the mRNA that would be transcribed from this strand of DNA?
214k views
5 votes
What is the mRNA that would be transcribed from this strand of DNA?

What is the mRNA that would be transcribed from this strand of DNA?-example-1
User KovBal
by
8.3k points

1 Answer

6 votes

Answer:

AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication

Step-by-step explanation:

User Leonardo Wildt
by
8.4k points
← Prev Question Next Question →

Related questions

User Sudhir Kumar
asked Aug 18, 2024 152k views
Where does the mRNA strand go once it has been transcribed?
Sudhir Kumar asked Aug 18, 2024
by Sudhir Kumar
8.1k points
1 answer
3 votes
152k views
Ask a Question
Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.

9.5m questions

12.2m answers

Other Questions

Which of the objects is living or nonliving: Bacteria, virus, moss, you, a lemon seed, the air, bread, lettuce and rocks?
Why aren't all minerals gemstones?
What are three important types of forces
Two methods of active transport
How can paleontologists help us understand the past
Link Copied!