Register
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT
24,684 views
8 votes
8 votes
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT

User Randomsock
by
2.3k points

1 Answer

9 votes
9 votes

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

User Abalos
by
2.8k points
Ask a Question
Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.

1.6m questions

2.0m answers

Other Questions

What if . . . you were a judge and you had a repeat offender for purse snatching in your courtroom? This individual has already been on probation and home incarceration. The individual has also spent a
What type of searches and seizures are protected against under the Fourth Amendment to the U.S. Constitution? unreasonable reasonable probable cause frisk
The major goal of __is to achieve a just and orderly society through a practical emphasis on social justice?
Ngành nghề nào nhà nước cấm đầu tư.?
Which of the following BEST describes the “rule of four”? A. The Supreme Court uses the rule of four after they have heard a case to decide whether they will issue an opinion on the case. B. The Supreme
Link Copied!