Question

Using the same, non-mutated sequence of DNA , repeat the process you just completed, but this time, for an insertion mutation. Randomly insert a base.

Original DNA gene: GATCGATACCATTCGGCGCATACTTCG

A)The mutated DNA sequence; highlight the insertion mutation.

B)The resulting MRNA sequence for each mutation:


C) The resulting amino acid sequence for each mutation (you will need the codon wheel chart for this):

Note: Begin translation at the first start codon, AUG, that you see when reading the MRNA sequence from left to-right. Stop translating the sequence when you reach first stop codon in the reading frame.

Answer 1

Insertion mutation involves adding a base to the DNA sequence, shifting the genetic code and possibly altering protein production. The specific impacts on the mRNA and amino acid sequence depend on the position of the mutation and can result in a frameshift that affects protein function.

Step-by-step explanation:

In insertion mutation, a base is added into the DNA sequence, causing a shift in the genetic code that can alter the protein produced. If we use the original DNA sequence GATCGATACCATTCGGCGCATACTTCG and insert a base (for this example, let's insert an A at the fifth position), the mutated DNA sequence would be GATCAAGATACCATTCGGCGCATACTTCG, where the inserted A is highlighted.

To find the resulting mRNA sequence, we first construct the complementary sequence to the mutated DNA and then transcribe it into mRNA. The complementary DNA sequence to the mutated strand is CTAGTTCTATGGTAAGCCGCGTATGAAGC, and the resulting mRNA sequence transcribed would be GAUCAUGUACCAUUCCGCGCAUACUUCG.

The initiation site for translation is the codon AUG. Assuming the insertion mutation does not remove or shift the AUG start codon, translation would begin at the first AUG and end at the first stop codon. The resulting amino acid sequence would be affected by the insertion mutation, shifting the reading frame and possibly changing every amino acid after the mutation, which could lead to a nonfunctional protein. The codon wheel chart is needed to match codons with their corresponding amino acids.

An insertion mutation can cause a frameshift, altering the entire sequence of codons, which can have significant effects on the protein's function if it alters essential amino acids or creates a premature stop codon. This is because each set of three nucleotides (a codon) specifies a particular amino acid, and frameshifts change how the codons are grouped.