Question

Using the gDNA sequence below, write a program that splits the sequence into coding and non-coding and write the result into two separate files. Hints: gDNA - (ACTGATCGATTACGTATAGTATTTGCTATCATCATACATATATCGATGCGTTCAT). Coding contains the exon on the first half (1-27) while non-coding contains nitron from the 28th character to the end.

a) `coding_sequence.txt` and `noncoding_sequence.txt`
b) `exon_sequence.txt` and `intron_sequence.txt`
c) `gene_sequence.txt` and `noncoding_sequence.txt`
d) `coding_region.txt` and `intronic_region.txt`

Answer 1

To split the gDNA sequence into coding and non-coding regions, use a program to extract the appropriate substrings and save them in separate files.

Step-by-step explanation:

To split the gDNA sequence into coding and non-coding regions and save them in separate files, you can write a program that extracts the substring from index 0 to 27 (inclusive) as the coding sequence and saves it in a file called coding_sequence.txt. The remaining characters from index 28 onwards can be extracted as the non-coding sequence and saved in a file called noncoding_sequence.txt.