117k views
0 votes
A gene from an E. coli bacterium cell was sequenced and a small stretch of this DNA is shown below. Only the start codon (AUG), plus 2 amino acids, and the stop codon (UAA, UAG, or UGA) of the protein are represented by this DNA sequence (i.e. the DNA downstream of the promoter, after the +1 site) 5 ′ - ACATGCCTAACTAGTTACATA - 3 ′ ′ 3 ′ - TGTACGGATTGATEAATGTAT - 5’ How many ATG codons are present in both strands?

2 Answers

6 votes

Final answer:

There is one ATG codon in the provided DNA sequence if we examine both the 5' to 3' and the 3' to 5' strands, considering both the actual ATG sequence and its complementary TAC sequence.

Step-by-step explanation:

The student asked how many ATG codons are present in both strands of a specific gene sequence from an E. coli bacterium. The ATG codon is significant because it serves as the start codon for translation, signaling the beginning of protein synthesis and setting the mRNA reading frame. In the DNA strands provided, one must look for the ATG sequence and its complement in order to count the total number of start codons.

Given the two complementary DNA strands:

  • 5' - ACATGCCTAACTAGTTACATA - 3'
  • 3' - TGTACGGATTGATCAATGTAT - 5'

By examining both strands for the ATG sequence as well as its complement (TAC on the opposite strand), we can identify the start codons. In these strands, the ATG codon appears only once in the provided sequence:

  • ATG is found in the 5' to 3' DNA strand as part of the sequence.

There are no TAC sequences on the 3' to 5' strand that would correspond to an ATG on its complementary strand within the sequence provided. Hence, there is only one ATG codon present.

4 votes

Final Answer:

The total count of ATG codons in both strands of the provided DNA sequence is three.

Step-by-step explanation:

In the provided DNA sequence, the complementary strand should be derived by replacing each base with its complementary nucleotide: A with T, T with A, C with G, and G with C. The given sequence 5′-ACATGCCTAACTAGTTACATA-3′ corresponds to its complementary sequence 3′-TGTACGGATTGATCAATGTAT-5′. An ATG codon represents the start codon for protein synthesis. In the original sequence, there is one ATG codon present at the beginning (ACATG), and when we consider the complementary strand, two additional ATG codons (TGTACG and ATG) are found. Therefore, a total of three ATG codons exist in both strands.

To count the ATG codons, it's crucial to consider both the given sequence and its complementary strand. The original sequence contains the ATG codon "ACATG" at the start, representing the start codon for the protein. Upon deriving the complementary strand, the sequence "TGTACG" corresponds to an ATG codon in the reverse direction. Additionally, another ATG codon "ATG" is identified in the complementary strand. Therefore, accounting for both the given sequence and its complement, the total count of ATG codons is three.

This calculation ensures the inclusion of all potential start codons (ATG) in the given DNA sequence and its complementary strand, providing an accurate count for the total occurrence of these specific codons involved in protein synthesis.

User Hussain Rahimi
by
7.4k points