26.5k views
0 votes
Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequences are always written 5' to 3')?

User Updogliu
by
8.1k points

1 Answer

7 votes
The probe would need to bind to the site
TTTTAGCCATTTACGATTAATCG

The sites that are bold are were the probe need to bind in order to target the DNA. The sequence of the prob needs a site that is complementary and antiparallel to it.
User Artur Siepietowski
by
9.2k points
Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.