179k views
2 votes
1. Replicate the following DNA segment 5’

agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’

1 Answer

3 votes

The answer is

tcgccctactcgcgtacaccgcgtattgac3’ 3’

agcgggatgagcgcatgtggcgcataactg5’

This is keeping in mind that purines (adenine and guanine) match with pyrimidines (cytosine and thymine). Adenine specifically pairs with Thyamine while Cytosine pairs with Guanine. Replication means the DNA is being duplicated therefore, the main enzyme is DNA polymerase. Were it transcription (involving transcription to RNA), adenines would match with Uracil


User Tary
by
8.4k points
Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.

9.4m questions

12.2m answers

Categories