The answer is
tcgccctactcgcgtacaccgcgtattgac3’ 3’
agcgggatgagcgcatgtggcgcataactg5’
This is keeping in mind that purines (adenine and guanine) match with pyrimidines (cytosine and thymine). Adenine specifically pairs with Thyamine while Cytosine pairs with Guanine. Replication means the DNA is being duplicated therefore, the main enzyme is DNA polymerase. Were it transcription (involving transcription to RNA), adenines would match with Uracil