45.2k views
0 votes
1.What is the function of a gene?

2.What do the letters you wrote on the graph paper stand for?








3.Which of the two strings of letters you used in this activity represent the gene?

1 Answer

2 votes

Answer:

1. the function of a gene is what makes up the human (proteins,characteristics,traits), you can say genes are little chunks of the DNA and lots of chunks is what makes up what is called chromosomes break that up u get chromatins.

2. the letters you wrote on the graph paper stand for what i like to call "DNA script" written form of DNA

exp: ATATTATAGCCGTATACGGC

3. hmmm... i dont get this one but if you were talking about it like this:

A : adenine

G: guanine these two are nucleotides with two rings

~batmans wife dun dun dun....

User Adrian Gonzales
by
6.7k points