Recent activity by Xlaudius

Recent activity by Xlaudius

A box of dog biscuits biscuits has 18 biscuits a box cost $2.88 how much does one biscuit cost

answered Nov 13, 2023

2 answers 211k views

If the width of the rectangle is 3 times the length and the perimeter of the rectangle is 72 ft, what are the length and width of the rectangle? Draw and label your rectangle. Write and solve a system

answered Sep 15, 2023

1 answer 181k views

Help with math pls !!!! lots of point

asked Aug 15, 2023

1 answer 222k views

Please help me! I will give 50 points! I have a test tomorrow and don't understand how to do this! Please explain step by step

asked Aug 11, 2023

1 answer 147k views

A right angle forms a square corner, like the shown below. Draw two angles that are open less than the right angle. Solve this Problem any way you choose

asked Jun 26, 2023

1 answer 89.3k views

Write an equation describing the relationship of the given variables. List variables in alphabetical order. One variable will go within each submission box.

answered Jun 24, 2023

1 answer 120k views

In Spanish, when "a" is followed by "el," they are combined to form "al."

answered May 20, 2023

1 answer 163k views

If there is inverse variation and y = 3 y = 3 when x = 24 x = 24 , find x x when y = 18 y = 18 . x = 1 x = 4 x = − 1 x = − 6

answered Feb 13, 2023

1 answer 152k views

Lines KS, ME, and YE are shown. Complete the table using the word bank to prove

asked Jan 18, 2023

1 answer 216k views

4 * x² - (6+y) when x = -2 and y = -9

asked Dec 12, 2022

1 answer 59.3k views

Which questions are True or False? 1.) ∡x is supplementary to 105°. 2.) The two angles in a linear pair have a sum of 180°. 3.) Vertical angles have the same measure. 4.) Complementary angles add up to

answered Dec 1, 2022

2 answers 151k views

Hiiiooo! Can somebody please help me! Much love❤️❤️❤️Thank you!! :D

answered Nov 16, 2022

1 answer 43.1k views

The formula for computing the feet is .

answered Oct 21, 2022

1 answer 12.7k views

What are your strength and weaknesses? List three of each.

answered Oct 18, 2022

2 answers 76.9k views

Two cars leave the park at the same time opposite directions one goes 3 times faster after 6 hours they travel 140miles how fast did theyg go

asked Aug 27, 2022

1 answer 92.6k views

How many sides does a regular polygon have if each interior angle measures 176^{\circ} ∘

answered Jul 2, 2022

2 answers 136k views

1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG mRNA: Codon: Anticodon: Amino Acids:

answered Jul 1, 2022

2 answers 93.6k views

A new curling iron costs $44.95. Annette currently has $25 and she plans to spend time babysitting to earn the rest of the money she needs. Annette charges $18 an hour to babysit. Which inequality could

answered Jun 9, 2022

1 answer 158k views

Differentiate between plains and plateaus.

answered May 22, 2022

1 answer 28.0k views

Somebody please do this

asked May 17, 2022

1 answer 99.9k views

Search QAmmunity.org