Recent activity by Thdoan

Recent activity by Thdoan

What is the setting in the story rock, ghost, willow, deer

asked Sep 22, 2024

1 answer 218k views

In a qualitative fit test, a challenge agent is used outside the respirator to see if the wearer of the respirator can detect it. One of the agents used is ____________. a) Strawberry scent b) Banana oil

asked Aug 26, 2024

1 answer 165k views

Which is not specifically targeted for destruction by the proteasome?

asked Aug 20, 2024

1 answer 6.3k views

Calculate the melting temperature of teh following DNA fragments using the sequences only: A. AGTCTGGGACGGCGCGGCAATCGCA B. TCAGACCCTGCCGCGCCGTTAGCGT C. TCAAAAATCGAATATTTGCTTATCTA D. AGTTTTTAGCTTATAAACGAATAGAT

asked Jun 8, 2024

1 answer 206k views

Explain ONE positive health effect likely to result from improved access to electricity in urban areas.

asked May 16, 2024

1 answer 146k views

Find a vector b such that the solution set of Ax=b is not a line parallel to the solution set of Ay=b.

answered May 14, 2024

1 answer 57.8k views

L1.3.3 Quiz: Understand Deeper Contextual Themes Question 4 of 10 Which theme is most typical of a creation story? A. A traveler takes a long, dangerous journey. B. Curiosity leads to the loss of something

asked Apr 13, 2024

1 answer 74.9k views

Using examples, explain the importance of Cnidarians to the marine ecosystem?

answered Mar 25, 2024

1 answer 115k views

Discuss two examples of stabilizing natural selection, using butterflies and goldenrod flies.

asked Feb 4, 2024

1 answer 211k views

*26) Allscott Company is developing its budgets for 2016 and for the first time, will use the kaizen approach. The initial 2016 income statement, based on static data from 2015, is as follows:* Sales (140,

answered Jan 18, 2024

1 answer 123k views

Consider this expression. m² - 7 + n² When m = -2and n = 5, the value of the expression is

answered Dec 15, 2023

1 answer 225k views

When marcus started school at 5 years old, his parents put $9,050 into a college fund account that earned 7.5% interest. what is the total amount in the account when he starts college at 18 years old?

answered Aug 31, 2023

1 answer 21.4k views

Why did President Kennedy start the Alliance for Progress program? to provide military aid to allies in Europe to improve relations with the Soviet Union to promote economic development in Africa to prevent

asked Jul 22, 2023

1 answer 234k views

Helppppppppppppp plsssssssssssssssss

answered Jul 19, 2023

1 answer 22.1k views

It was 47 degrees when Tanya got out of bed this morning. If the temperature rose 18 degrees by lunchtime, what temperature was it then?

asked May 3, 2023

1 answer 54.6k views

How could sharecroppers still be in debt even after the crop was sold?

answered Apr 28, 2023

2 answers 43.5k views

Carbon-14 is used for archeological carbon dating. Its half-life is 5730 years. How much of a 50-gram sample of Carbon-14 will be left in 1000 years?

asked Apr 11, 2023

1 answer 63.2k views

Expand the binomial using the Binomial Theorem. (3c − d)^3

asked Mar 21, 2023

1 answer 67.9k views

How did British policies increase tensions in the colonists ?

asked Mar 7, 2023

1 answer 214k views

I need help I need an A

answered Dec 8, 2022

2 answers 192k views

Search QAmmunity.org