Recent activity by Splact

Question

asked Dec 22, 2024

2 answers 144k views

The graphs of the function g(x) and its basic linear function f(x] = x are displayed. Indicate the transformation(s) of f(x) needed to create g(x). Note: Only factors of 0.5 or 2 are used for y-axis dilations.

answered Dec 16, 2024

1 answer 171k views

dabnus often has a hard time focusing on his studies because he is constantly thinking about all of the germs on his study materials. these intrusive thoughts are referred to as .

answered Dec 4, 2024

1 answer 180k views

When assessing a patient using the major body systems approach, which body system is typically not included in the assessment? A. Musculoskeletal B. Pulmonary C. Cardiovascular D. Genitourinary

answered Nov 18, 2024

1 answer 229k views

A new bridge.....over this river next year

asked Oct 20, 2024

1 answer 177k views

A point source is to be used with a concave mirror to produce a beam of parallel light. The source should be placed: midway between the focal point and the mirror O as close to the mirror as possible O

answered Sep 27, 2024

1 answer 225k views

What is the m(RNA) to TGACGGGTACTCGCTGGGGAAGCCCGAGCCCCTTACTTAGC but also starts with ACU

answered Sep 17, 2024

1 answer 149k views

Which of the following best summarizes a theme of the text A Horseman in the Sky? a) The impact of war on individuals b) The role of technology in warfare c) Cultural diversity in the military d) The symbolism

answered Aug 24, 2024

1 answer 93.3k views

Besides taking over Jewish businesses, how did non-Jewish business owners benefit from the setup of the ghettos?

answered Jul 26, 2024

2 answers 147k views

Question 2 of 10 Which of the following is considered a life-threatening environmental emergency? Heat exhaustion Heat stroke Exposure to rash-causing plant Tick bite Stry

asked Jul 19, 2024

1 answer 208k views

A(n) _____ contains the instructions your computer or device needs to run programs and apps. A) spreadsheet B) data file C) file extension D) executable file

asked Jul 17, 2024

1 answer 83.3k views

Which term describes the sense of collaboration, mutual respect, and working together that is typically associated with the Senate? a. Elitism b. Collegiality c. Filibuster d. Gerrymandering

asked Apr 23, 2024

1 answer 226k views

U.S. standards require a classified balance sheet with liabilities classified as either current or long term. a) True b) False

answered Apr 7, 2024

2 answers 49.8k views

343. Which of the following parenting styles results in the most socially responsible adults? (A) Authoritarian (B) Authoritative (C) Permissive (D) Autocratic (E) Sensitive

asked Feb 21, 2024

1 answer 203k views

A bug on a bicycle wheel moves in a circle through 40 radians. If the radius of thewheel is 0.6 meters in length, what is the total linear distance the rock moved? Note:give only your numerical answer.

answered Dec 1, 2023

1 answer 87.7k views

A backstory is the historical background of a story. information about the author of a story. information from a character’s past. the story’s message or lesson.

asked Sep 26, 2023

1 answer 116k views

Whether you are writing a fictional short story or a business letter, you will want to start organizing your paragraphs during the ___________________ stage. A) planning B) editing C) revising D) writing

answered Sep 5, 2023

2 answers 91.0k views

Help 20 points added

asked Aug 19, 2023

2 answers 196k views

Ben was shopping and saw that 46oz of peas cost $3.40. Calculate the unit price for 1 oz of peas. $____

answered Aug 8, 2023

1 answer 216k views

What mistake did George make? He laughed when the cat sat on the bench. He was ashamed of what he had done. He disobeyed and disappointed Papa. Info in image (please explain your reason why, so I know

asked Jun 24, 2023

1 answer 142k views

Ask a Question