Recent activity by Splact

Recent activity by Splact

How do you say 1000 in Spanish

asked Dec 22, 2024

2 answers 144k views

A new bridge.....over this river next year

asked Oct 20, 2024

1 answer 177k views

What is the m(RNA) to TGACGGGTACTCGCTGGGGAAGCCCGAGCCCCTTACTTAGC but also starts with ACU

answered Sep 17, 2024

1 answer 149k views

Besides taking over Jewish businesses, how did non-Jewish business owners benefit from the setup of the ghettos?

answered Jul 26, 2024

2 answers 147k views

Question 2 of 10 Which of the following is considered a life-threatening environmental emergency? Heat exhaustion Heat stroke Exposure to rash-causing plant Tick bite Stry

asked Jul 19, 2024

1 answer 208k views

A(n) _____ contains the instructions your computer or device needs to run programs and apps. A) spreadsheet B) data file C) file extension D) executable file

asked Jul 17, 2024

1 answer 83.3k views

U.S. standards require a classified balance sheet with liabilities classified as either current or long term. a) True b) False

answered Apr 7, 2024

2 answers 49.8k views

A bug on a bicycle wheel moves in a circle through 40 radians. If the radius of thewheel is 0.6 meters in length, what is the total linear distance the rock moved? Note:give only your numerical answer.

answered Dec 1, 2023

1 answer 87.7k views

A backstory is the historical background of a story. information about the author of a story. information from a character’s past. the story’s message or lesson.

asked Sep 26, 2023

1 answer 116k views

Whether you are writing a fictional short story or a business letter, you will want to start organizing your paragraphs during the ___________________ stage. A) planning B) editing C) revising D) writing

answered Sep 5, 2023

2 answers 91.0k views

Help 20 points added

asked Aug 19, 2023

2 answers 196k views

Ben was shopping and saw that 46oz of peas cost $3.40. Calculate the unit price for 1 oz of peas. $____

answered Aug 8, 2023

1 answer 216k views

What mistake did George make? He laughed when the cat sat on the bench. He was ashamed of what he had done. He disobeyed and disappointed Papa. Info in image (please explain your reason why, so I know

asked Jun 24, 2023

1 answer 142k views

Why did the Kindle succeed in the e-book market where other devices had failed?

asked Jun 23, 2023

1 answer 130k views

State WHAT IS DARK MATTER in paragraph form. Must have at least TWO PARAGRAPH'S.

asked Feb 26, 2023

1 answer 145k views

Suppose that y varies directly with .x, and y=-8 when x=2. (a) Write a direct variation equation that relates x and y. Equation: (b) Find y when x = 5. OC

asked Feb 25, 2023

1 answer 54.4k views

Ronmental Science 17.1.2 Quiz: Characteristics of Populations Question 1 of 10 What do members of a population have in common? Select all that apply. A. They live in the same area. OB. They have the same

asked Dec 25, 2022

1 answer 197k views

Could someone help with 15x-10 factorised

asked Nov 22, 2022

2 answers 221k views

How many times can 35 go into 130 and how much reminder

answered Nov 18, 2022

1 answer 64.0k views

If the variable overhead efficiency variance is $500 unfavorable and the variable overhead spending variance is $100 favorable, the journal entry will include a: (You may select more than one answer. Single

asked Nov 5, 2022

1 answer 196k views

Search QAmmunity.org