Recent activity by Shorpy

Recent activity by Shorpy

What does Kirchoff's loop rule say for a system that only has a battery and a light bulb attached?

answered Dec 30, 2023

1 answer 164k views

Is 12/5 a integer number?

asked Nov 19, 2023

1 answer 108k views

Sue loves to sew! She wants to make at least 6 pillows and no more than 10 blankets. Each pillowuses 2 yards of fabric and each blanket uses 12 yards of fabric. She can only use 48 yards of fabric intotal.

asked Aug 13, 2023

1 answer 39.6k views

Please help due today

asked Jun 12, 2023

1 answer 218k views

The quotient of two and the difference of four and a number

answered May 18, 2023

1 answer 33.5k views

Seventeen hundred tickets costing $5 each were sold for a scholarship fund-raiser. One prize of $2,000, 3 prizes of $1,000, and 5 prizes of $250 were given away. How much money did the scholarship fund-raiser

answered Apr 14, 2023

1 answer 179k views

Why was booker in Richmond

asked Jan 21, 2023

1 answer 161k views

Elastic Collisions are defined as....

answered Jan 18, 2023

2 answers 164k views

there are peaches 35 peaches that will be shared with equally by 5 people how many peaches will each get

asked Dec 25, 2022

1 answer 22.0k views

Perimeter describe in your own words

asked Dec 21, 2022

2 answers 73.3k views

Describe the term romanticism. How is it evident in the poems of the era? Be sure to include information related to poems from at least two authors. Support your response with evidence related to form,

answered Nov 29, 2022

1 answer 127k views

Please answer for me. No links no files no pics

answered Nov 21, 2022

1 answer 214k views

Can someone help me pls

answered Oct 21, 2022

1 answer 194k views

A peristaltic pump delivers a unit flow (Q1) of a highly viscous fluid. The network is depicted in Fig. P9.14. Every pipe section has the same length and diameter. The mass and mechanical energy balance

answered Sep 15, 2022

2 answers 112k views

Applying: Given the following DNA sequence from the template strand of a given gene: 5'CTTGCGTCACCTGAGACCTGGCATCG3' a) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label

asked Aug 25, 2022

1 answer 3.3k views

What is another name for a reading rehearsal?

answered Aug 14, 2022

1 answer 69.4k views

A keyboard costs £28 before the sale. work out the total cost of the computer and the keyboard.

answered Aug 1, 2022

2 answers 208k views

What 2 numbers multiply to 77 and add to 18

answered Jul 13, 2022

2 answers 28.2k views

Which is the largest interval over which the function shown in the table is increasing? A. X<-2 B. X<0 C. X>0 D. X>2

answered Jun 25, 2022

1 answer 112k views

2 sin^2 (x) + 3 sin (x) + 1 = 0 help me find the solution

asked May 14, 2022

1 answer 111k views

Search QAmmunity.org