Recent activity by Shankar Panda

Recent activity by Shankar Panda

Select the word that means a place with many confusing paths and passages.

asked Dec 24, 2023

1 answer 103k views

What is the average rate of change of the function f(x) = 2x^2 + 4 over the interval (-4,-1] ?

asked Dec 23, 2023

1 answer 415k views

jenny is preparing to install windows 10 on a system that has a version of windows 8.1 installed. this version of windows 8.1 runs slowly and crashes occasionally. the optical drive also does not work,

asked Nov 24, 2023

1 answer 116k views

The tell tale heart: Is the narrator reliable or unreliable? Explain why you think so.

asked Aug 4, 2023

2 answers 301k views

If on a scatter plot, there is a cluster of points that follow a certain trend, and one lone point far away that also follows that trend, is that lone point an outlier?

answered Jul 11, 2023

2 answers 222k views

Does someone know the answer to this?

answered Jun 30, 2023

2 answers 392k views

How many moles are there in 0.485 g of ethanol

asked May 15, 2023

1 answer 304k views

What is 20% of 85? To find out, first determine 10% of 85. What is 10% of 85?

answered May 5, 2023

2 answers 18.0k views

A mineral can be scratched by an iron nail. what can you conclude?

answered Apr 28, 2023

2 answers 37.3k views

INDEPENDENT PRACTICE 1. Angle 5 and 3 are vertical angles. 2. Angle 1 and 5 is a straight-line pair. 3. 4 and 3 are adjacent angles. 4. 4 and 1 are vertical angles. 5. 3 and 4 is a straight-line pair.

answered Mar 15, 2023

1 answer 57.7k views

Find the common ratio for the geometric sequence

answered Dec 27, 2022

1 answer 438k views

What is the mRNA in TACCGGATGCCAGATCAAATC?

answered Dec 9, 2022

1 answer 514k views

Kelly recorded the number of people who wore school shirts to the football game on Saturday. Of the 525 fans, 224 wore school shirts. If 840 people are expected to attend next Saturday, how many of them

asked Nov 28, 2022

1 answer 378k views

I need help!!!! I don’t unde

answered Sep 28, 2022

2 answers 519k views

Select the scripture that shows an example of contrasting parallelism (the proverb presents an idea in the first line with its opposite in the second line). Prov. 17:1 Better is a dry morsel, a quietness

asked Mar 20, 2022

1 answer 469k views

How to convert 6/8 divided 1/2 into mixed numbers

asked Jan 13, 2022

2 answers 469k views

Read the sentences. Jasmine grabbed a hat and gloves. Then she headed outside to play in the snow with Benita and Logan. She found them building a snowman. Which word is a subject pronoun in the sentences?

asked Jan 7, 2022

1 answer 410k views

Search QAmmunity.org