Recent activity by Rugden

Recent activity by Rugden

Why were northerners against texas becoming a state?

answered Dec 8, 2023

1 answer 52.0k views

for decades, social psychologists have endorsed gordon allport’s ideas about the conditions necessary for intergroup contact to reduce prejudice and discrimination. what is the goal of these "ideal" contact

answered Nov 6, 2023

1 answer 138k views

50 Points! A section of wall for a mural is shaped like a parallelogram with a base length of 7 feet and a height of 11 feet. A can of paint will cover 20 square feet. nvm it was 4

answered Sep 25, 2023

1 answer 215k views

A movie club surveyed 300 high school students. The students were asked how often they go to the movies and whether they prefer action movies or comedies.Their responses are summarized in the following

asked Sep 6, 2023

1 answer 190k views

I need help understand exponential functions

asked Aug 17, 2023

1 answer 98.0k views

19 Which of the following sentences is correctly capitalized? O A. The Chinese restaurant on Mockingbird Lane is great. OB. The Rangers will play the Cardinals in the world series. OC. Mom thinks that

answered Apr 22, 2023

1 answer 214k views

Find the three inequalities which define the shaded region on the prid. Answer [5]

answered Feb 16, 2023

1 answer 200k views

2. In the number 928,547,136, which digit is in the hundred thousands place?

asked Jan 22, 2023

1 answer 195k views

Im running for the nhs at my school, what would you do for your speech?

answered Jan 21, 2023

1 answer 52.7k views

Given the following information, prepare an income statement for the Dental Drilling Company. Selling and administrative expense $90,000 Depreciation expense 75,000 Sales 621,000 Interest expense 46,000

answered Dec 30, 2022

1 answer 221k views

What is the trait called that "showed" up or was "expressed" in all of the offspring? A. Offspring B. Heredity C. Dominant D. Recessive

asked Nov 1, 2022

1 answer 150k views

Un camión admite en su interior 68,25 toneladas de patatas. Se cada caja de patatas pesa 22,75 Kg, ¿cuántas cajas de patatas lleva el camión?

answered Oct 13, 2022

1 answer 114k views

Matrix addition is shown here. ([3,-2,3],[-5,2,11])=([-5,-4,4],[-4,2,-1])=([m,-6,-2],[-9,7,5]) Enter the value of s

asked Sep 13, 2022

1 answer 146k views

I need help finding the x

answered Aug 10, 2022

1 answer 84.4k views

2. You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are 3’ and which are 5’. template DNA 3’ CCTACGGTTCGTACCCCGTATGTGTAACTTGTCAT 5’

asked Jun 20, 2022

1 answer 114k views

Elo -- Cuando ves una película, żadónde vas? Voy al cine Cuando adónde vas? Cuando żadónde vas? - Cuando żadónde vas? - Cuando 2adónde vas? Sa

answered May 29, 2022

2 answers 116k views

Choose Verb in this sentence. Gabe wanted to play the guitar.

answered Apr 13, 2022

2 answers 207k views

Find the surface area. 1 m 10 m

answered Apr 12, 2022

1 answer 34.9k views

I need help ASAP please

answered Mar 6, 2022

1 answer 225k views

Please help me today is the last day of school and I already have a D in this class!!!!! help me!!!! 1. In the text, you read this about U.S. policy in the Middle East: The United States had strong ties

asked Mar 5, 2022

1 answer 52.4k views

Search QAmmunity.org