Recent activity by Robkuz

Recent activity by Robkuz

How many valence electrons are in an atom with the electron configuration in example A? a. 2 b. 6 c. 8 d. 10

answered Dec 20, 2024

1 answer 8.2k views

What benefits or advantages does performing proper abdominal crunches on a stability ball provide?

answered Dec 18, 2024

1 answer 222k views

Which of the following is NOT one of the six parameters which form the foundation of the earned value concept?A. BCWSB. ACWSC. BCWPD. ACWP

asked Dec 7, 2024

1 answer 49.9k views

Guidelines for caring for a resident with multiple sclerosis include (A) Rushing resident through tasks (B) Administering medications (C) Preventing falls (D) Encouraging the resident to speak faster

answered Nov 22, 2024

1 answer 58.2k views

Which of the following exemplifies a service? 1) candy 2) laptop 3) retail 4) D) car 5) laundry detergent

answered Nov 8, 2024

2 answers 66.8k views

The x-intercept is 60, which represents he number of monthly payments needed to repay the loan

asked Aug 19, 2024

1 answer 59.5k views

John ate 12 of a pizza for lunch, and he ate 1/3 of what was left for dinner. How much pizza did John eat for dinner? Option 1: 11 1/2 Option 2: 13 1/3 Option 3: 16 1/6 Option 4: 19 1/9

answered Aug 15, 2024

1 answer 68.4k views

Carlos prints and sells T-shirts for 14.99 each. Each month 5 T-shirts are misprinted and cannot be sold. How much money will he earn if he prints 22 T-shirts? How many T-shirts will he need to sell to

answered Aug 1, 2024

1 answer 111k views

For a poster layout, what elements should be considered for an information poster with diagrams on A4 size?

answered Jun 7, 2024

1 answer 50.9k views

Which revision fixes the misplaced modifier in the sentence? The chipmunk has created a burrow and helped itself to my garden that often scampers through the yard. a. The chipmunk has created a burrow

answered Jun 7, 2024

1 answer 118k views

List medical terms ending in -ography, -ogram, -oscopy, and -centesis.?

answered Jun 5, 2024

1 answer 134k views

Which family of microbes could belong to Eukaryote classification?

asked May 21, 2024

1 answer 105k views

CATCGATACCATTCGGCGCATACTTCG Translate the dna. Sequence

answered Mar 23, 2024

1 answer 149k views

DNA is a very long molecule that has chemicals in a special order. Parts of dna molecules are what we call?

asked Feb 12, 2024

1 answer 67.2k views

The chloroplast is a membrane-bound organelle that is surrounded by an outer membrane. Aside from the outer membrane of the chloroplast, how many other types of membranes can be found inside the chloroplast?

asked Feb 9, 2024

1 answer 27.2k views

Many factors must be considered in selecting the correct Victaulic gasket for a ____ service. A) Low-pressure B) High-pressure C) High-temperature D) Underground

answered Jan 25, 2024

1 answer 91.6k views

Do racially linked genetic traits explain many of the differences among athletes? 1) Yes 2) No

answered Jan 14, 2024

1 answer 120k views

Describe at least 3 ways the energy is generated?

answered Dec 28, 2023

2 answers 98.3k views

The prices and weights of three bags of dog food are shown below Brand A : $ 4.72 for 4 pounds Brand B : $ 15.97 for 14 pounds Brand C : $ 12.73 for 12 pounds If you choose among these three bags , what

answered Oct 12, 2023

1 answer 42.0k views

I really need help on this question. Im stuck any help?

asked Oct 7, 2023

1 answer 122k views

Search QAmmunity.org