Recent activity by Randomsock

Recent activity by Randomsock

K/2 =9 what is the step by step?

answered Nov 23, 2023

1 answer 355k views

Solve 12-ln(3-X) = 0

asked Nov 7, 2023

1 answer 285k views

Consider the following function.f(x) = x2x2 − 4 (a) Find the critical numbers of f. (Enter your answers as a comma-separated list.)x = (b) Find the open intervals on which the function is increasing or

asked Sep 19, 2023

1 answer 333k views

Match the demonstrative adjectives to complete the blanks in the provided sentences. 1. _______ tienda tiene una liquidación. 2. ¿Cuántos cuestan _______ zapatos de cuero? 3. Prefiero _____ vestido mediano.

answered Sep 13, 2023

2 answers 343k views

I NEED HELP Which table represents a function?хуA0 4142535x yXolo4B115U AUОсху26374849ху565 | 7D

answered Sep 12, 2023

1 answer 34.2k views

Ian invested $90,000 in an account paying an interest rate of 2. 6% compounded quarterly. Assuming no deposits or withdrawals are made, how much money, to the nearest dollar, would be in the account after

answered Sep 9, 2023

1 answer 232k views

In folk music who is king

asked Aug 25, 2023

1 answer 99.5k views

Can someone solve 1/2=6x+7(-3x-1/7)

asked Jan 8, 2023

1 answer 452k views

D. Write an original equation and solve. Eight fewer than twice the sum of x and 4 is 10.

asked Dec 15, 2022

1 answer 173k views

Solve for b: 16b = 12 A. b = 28 B. b = 3/4 C. b = 4/3 D. b = 1/4

asked Aug 6, 2022

2 answers 247k views

In NOP, the measure of ZP=90°, the measure of ZN=7°, and NO = 3.4 feet. Find the length of OP to the nearest tenth of a foot.

answered Apr 27, 2022

1 answer 468k views

sabrina the teenage witch star melissa joan hart won $1 million for charity on a celebrity version of which tv game show?

answered Apr 9, 2022

2 answers 13.7k views

What is the point slope and slope intercept of this graph below

asked Mar 24, 2022

1 answer 348k views

How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT

asked Mar 2, 2022

1 answer 24.7k views

2 Minutes, 55 Second In looking at this diagram, what would be the value of X? 3x (x + 2) OX= 24° OX= 44.59 OX= 22° OX= 44

asked Feb 8, 2022

1 answer 61.0k views

Search QAmmunity.org