Recent activity by PulseLab

Recent activity by PulseLab

Where was the first successful French settlement in North America.

answered Dec 31, 2023

1 answer 194k views

The main reason that Japanese Americans were placed in relocation camps during much of World War II was that they a. refused to fight for the United States b. were aiding the Japanese army c. were feared

asked Dec 26, 2023

1 answer 211k views

If x=-6, which inequality is true? A. -5 - 3x > 10 B. -3 - 5x < -14 C. 1 - 2x > 13 D. 2 - x<-3

asked Sep 20, 2023

1 answer 191k views

Which gear combination would you like to use when you want to pedal with as few strokes as possible and have your wheels turn as many times as possible

answered Aug 27, 2023

1 answer 144k views

PLEASE HELP ASAP! The United States has 12,383 miles of coastline. If 0.8% of the coastline is located in Georgia, about how many miles of coastline are in Georgia?

answered Aug 16, 2023

2 answers 61.0k views

A medical emergency is a sudden or unexpected condition

asked Jun 10, 2023

1 answer 81.1k views

Which of the two triangles has an area of 68 square units?

asked May 18, 2023

1 answer 2.3k views

There never was a time when the world was without fire, but there was a time when men did not know how to kindle fire; and after they learned how to kindle one, it was a long, long time before they learned

answered Feb 27, 2023

2 answers 178k views

15m of the ice cream truck tell the reader about the characters in the passage? 1. Eve and Nick long to have the relaxed summer freedom that the ice cream truck represents. 0 2. Eve and Nick want to please

answered Dec 16, 2022

1 answer 156k views

A soccer player's average during her first two seasons was 1.4 goals per game. There are five games in the current season; she scored 2, 0, 1, and 1 goals in the first four games of this season. If she

answered Dec 10, 2022

1 answer 47.0k views

Given the following DNA strand TACGTATGCCGTATGGGCATT a) What is the DNA compliment to given strand? b) What is the mRNA compliment to the given strand?

answered Nov 24, 2022

1 answer 218k views

Please help with this. This is a major grade

answered Nov 17, 2022

1 answer 211k views

X raise to the fourth power three times

answered Nov 1, 2022

1 answer 17.3k views

Please help me with this, im literally so confused.

answered Oct 18, 2022

2 answers 16.7k views

Need help ASAP lol..

answered Sep 26, 2022

1 answer 185k views

PLEASE IM TIMED After simplifying, what will x be equivalent to? a5*a6=ax

answered Sep 19, 2022

1 answer 205k views

Ten less than the product of 5 and the difference of a number and one is twice the number. What is the number?

answered Sep 6, 2022

1 answer 175k views

How does a swamp act as a natural water treatment plant which humans should preserve

answered Jun 8, 2022

1 answer 199k views

A weight is attached to the end of a spring. Its height after t seconds is given by the equation h(t)=5−2sin((2π(t+1))/7) When does the weight first reach its maximum height? Give an exact answer.

asked May 16, 2022

1 answer 105k views

When European settlers came to North America, they brought their European seeds with them. When Africans were brought to North America as slaves, they brought African food with them. Based on this information,

answered Apr 19, 2022

2 answers 2.6k views

Search QAmmunity.org