Recent activity by Popokoko

Question

How does the walk to the well-house impact Helen Keller's experiences and development, particularly in terms of her memories, attitude, ability to communicate with her teacher, and her understanding of

asked Dec 4, 2024

1 answer 231k views

Commanders may direct drug testing under what conditions? a. Randomly, without cause b. Only if there is reasonable suspicion c. After an individual has completed rehabilitation d. During public holidays

answered Nov 1, 2024

1 answer 95.2k views

These two short sequence reads from two different recombinant plasmids overlap to form a contig. How long (in bp) is this contig? Write the number only. Seq#1: CGCGTAGGGACTCTCTAGAAGGG Seq#2: GTAAGGGCGCATATATCCCTTCTAGA

answered Nov 1, 2024

1 answer 98.9k views

To recruit for the following jobs, for which job would it be the most costly if recruiters make a false positive error? a. Airline Pilot b. Software Developer c. Restaurant Server d. Surgeon

answered Oct 24, 2024

1 answer 229k views

Measurements were made on nine widgets. You know that the distribution of widget measurements has historically been close to normal, but suppose that you do not know. a) Use a t-test for small sample sizes

answered Oct 6, 2024

1 answer 56.0k views

Under pressure to open new accounts, a bank employee creates savings accounts in the names of current customers. The accounts are small, and a fee is deducted from their current accounts to cover the new

asked Sep 18, 2024

1 answer 115k views

The continuation of one line of poetry onto another line and is less rhythmic

answered Sep 14, 2024

1 answer 89.2k views

In the nineteenth century, the ottoman and austro-hungarian empires were two examples of?

answered Sep 12, 2024

1 answer 10.3k views

Photosystem I produces: Select one: a. ATP b. NADPH c. Glucose d. Both A and C are correct e. None of the above are correct

answered Jul 19, 2024

1 answer 118k views

What questions should you ask when you are deciding what type of funding documents to use?

asked Jul 9, 2024

1 answer 210k views

in a sequence, the first term is 12 and the common differences 4. What is the 10th term of the sequence?

asked Jun 17, 2024

1 answer 214k views

Can someone please help me with this question? Solve for X: (You’re working with degrees) Answers: x = 35 x = 5 x = 17 x = 7

answered Jun 17, 2024

1 answer 10.3k views

Hygiene hypothesis and how it relates to infections, asthma, allergies, autoimmune diseases?

asked Jun 10, 2024

1 answer 235k views

Most people would agree that anxiety can lead to sleep loss. However, Dr. Jenkins believes that sleep deprivation can also cause increased anxiety. Which research method would allow him to test a cause-effect

answered May 31, 2024

1 answer 142k views

How is a balloon like a cell membrane?

answered Nov 25, 2023

1 answer 183k views

Hi I need help with these questions thank you. A teacher walks around the room while students are taking a test. If he walks 8 m North, 6 m East, 8 m South, and 6 m West, what is his displacement? 28 m

asked Nov 21, 2023

1 answer 130k views

Failure is something that nobody wants to experience. Being unsuccessful often leaves people feeling a bit low. How do you overcome obstacles/adversity in your life? help me to answer this

answered Nov 2, 2023

2 answers 28.5k views

Attend to Precision An ice cream shop owner considers two pricing options for serving a cup of ice cream plus toppings $3 for the ice cream and $0.75 per topping or $4.50 for the ice cream and $0.50 per

asked Oct 17, 2023

1 answer 62.8k views

A lunar eclipse occurs when the Moon casts a shadow on the Earth.

answered Jun 29, 2023

1 answer 74.3k views

The first modern management articles were published in ________ journals.

answered Apr 29, 2023

1 answer 59.3k views

Ask a Question