Recent activity by Oggmonster

Recent activity by Oggmonster

Using the gDNA sequence below, write a program that splits the sequence into coding and non-coding and write the result into two separate files. Hints: gDNA - (ACTGATCGATTACGTATAGTATTTGCTATCATCATACATATATCGATGCGTTCAT).

asked Dec 6, 2024

1 answer 108k views

How to convert whole number to radical on a junios calculator?

asked Oct 26, 2024

1 answer 116k views

An analyst is cleaning a new dataset containing 500 rows. They want to make sure the data contained from cell b2 through cell b300 does not contain a number greater than 50. Write the statement that includes

asked Sep 16, 2024

1 answer 8.5k views

What does the blood vessel that runs down the middle of a haversian system provide? 1) Oxygen to the bone cells 2) Nutrients to the bone cells 3) Waste removal from the bone cells 4) All of the above

answered Jul 8, 2024

1 answer 71.3k views

B = { x: 1≤ x ≤ 11 where x is a prime number} What is x?

asked Jul 5, 2024

1 answer 71.6k views

An investment of $25,000 earns 2.65% annual interest and is compounded continuously. If no funds are added or removed from this account, what is the future value of the investment after 5 years?

answered Jun 8, 2024

1 answer 95.0k views

Zack used these steps to solve this equation: When Zack checked his solution, it didn't work. What was his mistake? u+5-- -9 Step 1: y + 5- -9 Step 2: y = -14 Siep 3 ()y-4() Step 4: y=-21 In step 1, he

answered May 20, 2024

1 answer 58.8k views

Describe examples of Native Americans adopting Spanish culture and rejecting Spanish culture. a. Adoption of Spanish language, clothing, and religion. b. Rejection of Spanish cuisine and music. c. Preservation

asked Apr 27, 2024

1 answer 151k views

In 2011, the total country A debit card purchases were $1.8 trillion, up 33% from 2010. What were the total country A debit card purchases in 2010?

answered Mar 28, 2024

1 answer 59.3k views

According to the ability to pay principle of taxation, people who have higher incomes should pay a larger share of their income in tax. true or false

asked Feb 1, 2024

1 answer 52.7k views

A recipe for 20 rolls calls for five tablespoons of outter. How many tablespoons of butter are needec or thirty rolls?

answered Jan 16, 2024

1 answer 221k views

Pls tell/show me how u did it Also the answer that there is worng

answered Dec 21, 2023

2 answers 152k views

Find an ordered pair (x, y) that is a solution to the equation x-6y=6

answered Dec 5, 2023

1 answer 216k views

How is cognitive therapy different from rational-emotive therapy?.

asked Nov 25, 2023

1 answer 187k views

Convert 31 °C to Fahrenheit Round your answer to the nearest tenth.

answered Oct 10, 2023

1 answer 149k views

Plllllllssssss heeeellllp

asked Sep 26, 2023

1 answer 150k views

I have to determine the coordinates of the x-intercepts of the parabola. please help I need assistance with this practice problem.

answered Jun 20, 2023

1 answer 134k views

Read the sentence. the works of charles dickens a famous british writer include david copperfield and oliver twist. which is the best revision of this sentence?

asked Jun 5, 2023

1 answer 138k views

Quadrilateral EFGH is similar to quadrilateral IJKL. Find the measure of side LI. Round your answer to the nearest tenth if necessary. Figures are not drawn to scale.

answered Feb 14, 2023

1 answer 107k views

Can someone make some hyperboles to persuade someone to draw please? Hyperboles - exaggerated statements or claims not meant to be taken literally.

asked Feb 7, 2023

1 answer 163k views

Search QAmmunity.org