Recent activity by NorTicUs

Recent activity by NorTicUs

5. A laborer who travels away from where he or she lives to find work is called a O O O compound diverse worker migrant worker nomadic herder

asked Dec 19, 2023

1 answer 166k views

In a cell replicating the DNA fragment of Figure 7, the non-coding strand (II) is used as a template for the synthesis of the coding strand (I).5 AAAAAAATGGTGCACCTTACGCCAGAGGAG 3¹ (1) 3 TTTTTTTACCACGTGGAATGCGGTCTCCT

answered Nov 8, 2023

1 answer 56.7k views

Does x=y-1 represent a fraction ?

answered Oct 17, 2023

2 answers 189k views

Are architecture is hard

answered Jul 16, 2023

1 answer 188k views

Help me with this, please! Very thankful!

asked Jul 2, 2023

2 answers 184k views

What is the equation of the directrixfor the following parabola:(x - 1)2 = 12(y + 2)

asked Jun 10, 2023

1 answer 57.6k views

Write a balanced equation for the transmutation that occurs when a polonium-195 nucleus undergoes alpha decay. A. 19584Po→19585At+0−1e 84 195 P o → 85 195 A t + − 1 0 e B. 19584Po→19583Bi+01e 84 195 P

asked Mar 26, 2023

1 answer 158k views

hi hope your doing great. can you work the math problem answer the long way( +-xor /) result the long way pls

asked Mar 23, 2023

1 answer 50.1k views

Fill in the blanks: An ___________ measures wind speed and a _________ shows wind direction. A.weather balloon; electroscope B.anemometer; wind vane C.flask; beaker D.oscilloscope; seismograph It's science

asked Jan 19, 2023

2 answers 59.8k views

5.6x10^11-1.12x10^10=

answered Nov 23, 2022

1 answer 177k views

Refer to these stories from the Iliad: "Agamemnon's Appeal to Achilles" and "The Arming of Patroclus." Which incident helps develop the theme that human life is fleeting in "The Arming of Patroclus"? Achilles

answered Nov 11, 2022

2 answers 143k views

When and where was the “Sharecropper Contract“ written?

answered Aug 28, 2022

1 answer 102k views

HELP PLEASE solve the following equation for x. 9-x/2+2= SHOW WORK

asked Aug 3, 2022

1 answer 5.2k views

1/8 plus 3/4: lolz tell me u need help

answered Jul 23, 2022

2 answers 176k views

How many carbon atoms are in 26-hydrogen alkyne

answered Jul 17, 2022

1 answer 152k views

What is the difference between civic duties and civic responsibilities? 1-Civic duties are required by law, while civic responsibilities are done voluntarily. 2-Civic duties require a large amount of personal

asked Jun 10, 2022

1 answer 48.7k views

Anyone know this problem?

answered Apr 28, 2022

2 answers 64.8k views

Simplify in decimal form 12 * 2 / 5 =

answered Mar 31, 2022

2 answers 134k views

What is the wavelength of a light of frequency 7.21 % 1014 Hz?

answered Mar 28, 2022

1 answer 7.6k views

Which of the following is a solution to the inequality below? 4 - V > 12 V-8 V="12 V-6 Submit

asked Mar 13, 2022

1 answer 35.3k views

Search QAmmunity.org